\
| Variant ID: vg0112183141 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 12183141 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, G: 0.00, others allele: 0.00, population size: 304. )
GCATGACATACGTTACGCTCGCCGGCCGATGTCATTGATCAACAAGGTACGTCGTCATTGATCACTGTGTGTTTTTGGCCTAAAAAATGAGTTAGCTATC[C/G]
AAGTCTTTCCCTTTTTTTTAATCCTTACATATACATTGACGTAGCCATTAGAAGTTTGTTTATAATTTCTTTTTCACTGCAACATAACCGGAAAATAGGC
GCCTATTTTCCGGTTATGTTGCAGTGAAAAAGAAATTATAAACAAACTTCTAATGGCTACGTCAATGTATATGTAAGGATTAAAAAAAAGGGAAAGACTT[G/C]
GATAGCTAACTCATTTTTTAGGCCAAAAACACACAGTGATCAATGACGACGTACCTTGTTGATCAATGACATCGGCCGGCGAGCGTAACGTATGTCATGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.10% | 15.40% | 0.30% | 5.18% | NA |
| All Indica | 2759 | 72.40% | 26.00% | 0.25% | 1.38% | NA |
| All Japonica | 1512 | 85.80% | 0.10% | 0.46% | 13.56% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.90% | 7.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 78.50% | 18.50% | 0.00% | 3.01% | NA |
| Indica III | 913 | 60.80% | 38.30% | 0.22% | 0.66% | NA |
| Indica Intermediate | 786 | 67.40% | 29.80% | 0.51% | 2.29% | NA |
| Temperate Japonica | 767 | 88.00% | 0.10% | 0.52% | 11.34% | NA |
| Tropical Japonica | 504 | 78.00% | 0.20% | 0.60% | 21.23% | NA |
| Japonica Intermediate | 241 | 95.40% | 0.00% | 0.00% | 4.56% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0112183141 | C -> G | LOC_Os01g21710.1 | upstream_gene_variant ; 1716.0bp to feature; MODIFIER | silent_mutation | Average:53.839; most accessible tissue: Zhenshan97 root, score: 80.909 | N | N | N | N |
| vg0112183141 | C -> G | LOC_Os01g21720.1 | downstream_gene_variant ; 4809.0bp to feature; MODIFIER | silent_mutation | Average:53.839; most accessible tissue: Zhenshan97 root, score: 80.909 | N | N | N | N |
| vg0112183141 | C -> G | LOC_Os01g21700-LOC_Os01g21710 | intergenic_region ; MODIFIER | silent_mutation | Average:53.839; most accessible tissue: Zhenshan97 root, score: 80.909 | N | N | N | N |
| vg0112183141 | C -> DEL | N | N | silent_mutation | Average:53.839; most accessible tissue: Zhenshan97 root, score: 80.909 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0112183141 | NA | 7.46E-06 | mr1071 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112183141 | NA | 3.83E-06 | mr1080 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112183141 | NA | 2.29E-06 | mr1200 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112183141 | NA | 6.49E-06 | mr1395 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112183141 | 2.88E-06 | 2.93E-08 | mr1613 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112183141 | NA | 4.80E-06 | mr1618 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112183141 | NA | 9.18E-07 | mr1619 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112183141 | NA | 6.49E-06 | mr1911_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |