\
| Variant ID: vg0112179197 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 12179197 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 85. )
AACAGTTAGATAGGCTACCCCAAATATTGTACTGGTGTGATTATGGTGACACTACAAGGAATCTGTTAATGCGTGATGAAAAAATTCCGTCACGGATCAT[C/T]
AAAAAACCGTCACTATGCAGCACCTGTGATGGTTTCAGAGATGGTCACGGATTGAGCGTCATGGATTAACCTCTGTGACGGTTTACCAAAAACCATCACG
CGTGATGGTTTTTGGTAAACCGTCACAGAGGTTAATCCATGACGCTCAATCCGTGACCATCTCTGAAACCATCACAGGTGCTGCATAGTGACGGTTTTTT[G/A]
ATGATCCGTGACGGAATTTTTTCATCACGCATTAACAGATTCCTTGTAGTGTCACCATAATCACACCAGTACAATATTTGGGGTAGCCTATCTAACTGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 11.20% | 5.60% | 5.73% | 77.44% | NA |
| All Indica | 2759 | 0.90% | 0.50% | 8.23% | 90.36% | NA |
| All Japonica | 1512 | 32.30% | 15.70% | 2.65% | 49.40% | NA |
| Aus | 269 | 0.70% | 0.40% | 1.49% | 97.40% | NA |
| Indica I | 595 | 0.70% | 0.00% | 1.68% | 97.65% | NA |
| Indica II | 465 | 1.50% | 1.10% | 4.52% | 92.90% | NA |
| Indica III | 913 | 0.30% | 0.20% | 16.65% | 82.80% | NA |
| Indica Intermediate | 786 | 1.30% | 1.00% | 5.60% | 92.11% | NA |
| Temperate Japonica | 767 | 52.70% | 5.70% | 2.35% | 39.24% | NA |
| Tropical Japonica | 504 | 1.00% | 33.30% | 3.37% | 62.30% | NA |
| Japonica Intermediate | 241 | 32.80% | 10.40% | 2.07% | 54.77% | NA |
| VI/Aromatic | 96 | 0.00% | 1.00% | 0.00% | 98.96% | NA |
| Intermediate | 90 | 17.80% | 12.20% | 0.00% | 70.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0112179197 | C -> T | LOC_Os01g21700.1 | downstream_gene_variant ; 2471.0bp to feature; MODIFIER | silent_mutation | Average:21.118; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0112179197 | C -> T | LOC_Os01g21700-LOC_Os01g21710 | intergenic_region ; MODIFIER | silent_mutation | Average:21.118; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0112179197 | C -> DEL | N | N | silent_mutation | Average:21.118; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0112179197 | NA | 5.43E-06 | mr1128_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | NA | 4.39E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | NA | 1.04E-06 | mr1204_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | NA | 8.25E-07 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | NA | 6.41E-08 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | NA | 2.82E-06 | mr1374_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | 1.01E-06 | 4.15E-07 | mr1440_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | 1.06E-06 | 1.06E-06 | mr1440_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | NA | 1.16E-08 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | NA | 4.73E-06 | mr1556_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | NA | 8.64E-06 | mr1556_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | NA | 9.06E-06 | mr1646_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | NA | 2.38E-06 | mr1665_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | NA | 1.21E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | 2.83E-06 | 1.00E-07 | mr1687_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | 6.81E-06 | 6.81E-06 | mr1687_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | 2.26E-06 | 2.26E-06 | mr1811_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | NA | 2.70E-06 | mr1896_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112179197 | NA | 6.99E-06 | mr1984_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |