\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112172810:

Variant ID: vg0112172810 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12172810
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTACTTTTACAAGCAAAAAGAAAATCACAAATAGACCAACTACTAGGTCTAGCAGCTCTCCCTTCGTCTCTTTAAAAATCCTATGAGTGCTTCTAAATC[A/G]
CTACGTGGTGCTATTAAATTAGAGAAGGTACTAAAAAAATACAAAGCAACTGACCATCAGTTTCTACTTAAATTGATGCATTTAGGTTGTTATATATTTT

Reverse complement sequence

AAAATATATAACAACCTAAATGCATCAATTTAAGTAGAAACTGATGGTCAGTTGCTTTGTATTTTTTTAGTACCTTCTCTAATTTAATAGCACCACGTAG[T/C]
GATTTAGAAGCACTCATAGGATTTTTAAAGAGACGAAGGGAGAGCTGCTAGACCTAGTAGTTGGTCTATTTGTGATTTTCTTTTTGCTTGTAAAAGTAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 24.60% 0.28% 0.25% NA
All Indica  2759 96.60% 3.20% 0.18% 0.04% NA
All Japonica  1512 36.90% 62.00% 0.46% 0.66% NA
Aus  269 66.50% 33.50% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.40% 1.90% 0.65% 0.00% NA
Indica III  913 96.10% 3.60% 0.22% 0.11% NA
Indica Intermediate  786 94.10% 5.90% 0.00% 0.00% NA
Temperate Japonica  767 53.50% 46.20% 0.39% 0.00% NA
Tropical Japonica  504 11.90% 85.90% 0.20% 1.98% NA
Japonica Intermediate  241 36.50% 62.20% 1.24% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 68.90% 28.90% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112172810 A -> G LOC_Os01g21700.1 upstream_gene_variant ; 3347.0bp to feature; MODIFIER silent_mutation Average:35.838; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg0112172810 A -> G LOC_Os01g21690.1 downstream_gene_variant ; 2395.0bp to feature; MODIFIER silent_mutation Average:35.838; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg0112172810 A -> G LOC_Os01g21690-LOC_Os01g21700 intergenic_region ; MODIFIER silent_mutation Average:35.838; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg0112172810 A -> DEL N N silent_mutation Average:35.838; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112172810 NA 2.97E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0112172810 NA 1.04E-16 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810 NA 2.57E-14 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810 NA 1.20E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810 NA 2.29E-20 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810 NA 6.85E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810 NA 1.05E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810 NA 1.80E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810 4.64E-06 6.25E-26 mr1164_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810 NA 5.32E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810 NA 1.66E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810 NA 5.73E-15 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810 NA 2.36E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810 NA 3.77E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810 NA 3.34E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810 NA 7.18E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810 NA 5.40E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810 NA 4.71E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251