Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112172810:

Variant ID: vg0112172810 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 12172810
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTACTTTTACAAGCAAAAAGAAAATCACAAATAGACCAACTACTAGGTCTAGCAGCTCTCCCTTCGTCTCTTTAAAAATCCTATGAGTGCTTCTAAATC[A/G]
CTACGTGGTGCTATTAAATTAGAGAAGGTACTAAAAAAATACAAAGCAACTGACCATCAGTTTCTACTTAAATTGATGCATTTAGGTTGTTATATATTTT

Reverse complement sequence

AAAATATATAACAACCTAAATGCATCAATTTAAGTAGAAACTGATGGTCAGTTGCTTTGTATTTTTTTAGTACCTTCTCTAATTTAATAGCACCACGTAG[T/C]
GATTTAGAAGCACTCATAGGATTTTTAAAGAGACGAAGGGAGAGCTGCTAGACCTAGTAGTTGGTCTATTTGTGATTTTCTTTTTGCTTGTAAAAGTAAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.80%	24.60%	0.28%	0.25%	NA
All Indica	2759	96.60%	3.20%	0.18%	0.04%	NA
All Japonica	1512	36.90%	62.00%	0.46%	0.66%	NA
Aus	269	66.50%	33.50%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.40%	1.90%	0.65%	0.00%	NA
Indica III	913	96.10%	3.60%	0.22%	0.11%	NA
Indica Intermediate	786	94.10%	5.90%	0.00%	0.00%	NA
Temperate Japonica	767	53.50%	46.20%	0.39%	0.00%	NA
Tropical Japonica	504	11.90%	85.90%	0.20%	1.98%	NA
Japonica Intermediate	241	36.50%	62.20%	1.24%	0.00%	NA
VI/Aromatic	96	77.10%	22.90%	0.00%	0.00%	NA
Intermediate	90	68.90%	28.90%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0112172810	A -> G	LOC_Os01g21700.1	upstream_gene_variant ; 3347.0bp to feature; MODIFIER	silent_mutation	Average:35.838; most accessible tissue: Zhenshan97 flag leaf, score: 49.845	N	N	N	N
vg0112172810	A -> G	LOC_Os01g21690.1	downstream_gene_variant ; 2395.0bp to feature; MODIFIER	silent_mutation	Average:35.838; most accessible tissue: Zhenshan97 flag leaf, score: 49.845	N	N	N	N
vg0112172810	A -> G	LOC_Os01g21690-LOC_Os01g21700	intergenic_region ; MODIFIER	silent_mutation	Average:35.838; most accessible tissue: Zhenshan97 flag leaf, score: 49.845	N	N	N	N
vg0112172810	A -> DEL	N	N	silent_mutation	Average:35.838; most accessible tissue: Zhenshan97 flag leaf, score: 49.845	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0112172810	NA	2.97E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0112172810	NA	1.04E-16	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810	NA	2.57E-14	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810	NA	1.20E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810	NA	2.29E-20	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810	NA	6.85E-08	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810	NA	1.05E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810	NA	1.80E-15	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810	4.64E-06	6.25E-26	mr1164_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810	NA	5.32E-07	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810	NA	1.66E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810	NA	5.73E-15	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810	NA	2.36E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810	NA	3.77E-21	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810	NA	3.34E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810	NA	7.18E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810	NA	5.40E-10	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112172810	NA	4.71E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251