Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112126841:

Variant ID: vg0112126841 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12126841
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTACACACTTATTTACCATGTACGCCGGTAATACTGTGCACAGGCCTGTCCCGCCGCCTGCCACTCGGAGAGAACATGCGCGGGCACTAATTGGTGGCCA[C/T]
GGCGACGCCGGATCCTCCACGGGAAGTGGCTGAAGCACATCTTGTGCTCCGCCGGCGGTCGCAGCAAGGCCGAGCGCCGACGACATGTCTGCAGCACTTC

Reverse complement sequence

GAAGTGCTGCAGACATGTCGTCGGCGCTCGGCCTTGCTGCGACCGCCGGCGGAGCACAAGATGTGCTTCAGCCACTTCCCGTGGAGGATCCGGCGTCGCC[G/A]
TGGCCACCAATTAGTGCCCGCGCATGTTCTCTCCGAGTGGCAGGCGGCGGGACAGGCCTGTGCACAGTATTACCGGCGTACATGGTAAATAAGTGTGTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.60% 8.30% 0.11% 0.00% NA
All Indica  2759 85.90% 14.00% 0.14% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.60% 2.20% 0.17% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 71.90% 28.00% 0.11% 0.00% NA
Indica Intermediate  786 86.10% 13.60% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112126841 C -> T LOC_Os01g21640.1 missense_variant ; p.Arg71Trp; MODERATE nonsynonymous_codon ; R71W Average:80.311; most accessible tissue: Zhenshan97 young leaf, score: 89.772 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0112126841 C T -0.02 -0.01 -0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112126841 8.33E-06 NA Awn_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0112126841 NA 2.44E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112126841 NA 8.25E-07 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112126841 NA 7.42E-09 mr1510_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112126841 NA 1.33E-07 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112126841 NA 9.89E-07 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251