\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112116426:

Variant ID: vg0112116426 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12116426
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAAAGAAATATTAAAAGACGAGTCTAGAGTCCATATAGGAATATATATAATTTACAAATAACTAAAATTTGATATTAAAAATAATTAATAACTAACAC[G/A]
TATATAAAATATAATATGAATATTACACATTAGTTGTTTTGTAAAGTTGTTGCAAAATTTAAAATTATGTTGTCATTTTAATATATTTGAATAATATAAT

Reverse complement sequence

ATTATATTATTCAAATATATTAAAATGACAACATAATTTTAAATTTTGCAACAACTTTACAAAACAACTAATGTGTAATATTCATATTATATTTTATATA[C/T]
GTGTTAGTTATTAATTATTTTTAATATCAAATTTTAGTTATTTGTAAATTATATATATTCCTATATGGACTCTAGACTCGTCTTTTAATATTTCTTTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.50% 8.80% 0.63% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 71.90% 26.20% 1.92% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 77.80% 19.80% 2.35% 0.00% NA
Tropical Japonica  504 54.00% 44.40% 1.59% 0.00% NA
Japonica Intermediate  241 90.50% 8.30% 1.24% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112116426 G -> A LOC_Os01g21630.1 upstream_gene_variant ; 681.0bp to feature; MODIFIER silent_mutation Average:22.627; most accessible tissue: Callus, score: 33.74 N N N N
vg0112116426 G -> A LOC_Os01g21620.1 downstream_gene_variant ; 2582.0bp to feature; MODIFIER silent_mutation Average:22.627; most accessible tissue: Callus, score: 33.74 N N N N
vg0112116426 G -> A LOC_Os01g21620-LOC_Os01g21630 intergenic_region ; MODIFIER silent_mutation Average:22.627; most accessible tissue: Callus, score: 33.74 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112116426 6.25E-07 NA Plant_height All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0112116426 NA 9.97E-16 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0112116426 2.96E-06 NA Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0112116426 NA 8.04E-07 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112116426 NA 9.03E-06 mr1149 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112116426 NA 1.11E-06 mr1991 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112116426 5.85E-07 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112116426 NA 8.47E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112116426 2.64E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112116426 NA 3.58E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251