Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112116426:

Variant ID: vg0112116426 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 12116426
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAAAGAAATATTAAAAGACGAGTCTAGAGTCCATATAGGAATATATATAATTTACAAATAACTAAAATTTGATATTAAAAATAATTAATAACTAACAC[G/A]
TATATAAAATATAATATGAATATTACACATTAGTTGTTTTGTAAAGTTGTTGCAAAATTTAAAATTATGTTGTCATTTTAATATATTTGAATAATATAAT

Reverse complement sequence

ATTATATTATTCAAATATATTAAAATGACAACATAATTTTAAATTTTGCAACAACTTTACAAAACAACTAATGTGTAATATTCATATTATATTTTATATA[C/T]
GTGTTAGTTATTAATTATTTTTAATATCAAATTTTAGTTATTTGTAAATTATATATATTCCTATATGGACTCTAGACTCGTCTTTTAATATTTCTTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.50%	8.80%	0.63%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	71.90%	26.20%	1.92%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	77.80%	19.80%	2.35%	0.00%	NA
Tropical Japonica	504	54.00%	44.40%	1.59%	0.00%	NA
Japonica Intermediate	241	90.50%	8.30%	1.24%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	10.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0112116426	G -> A	LOC_Os01g21630.1	upstream_gene_variant ; 681.0bp to feature; MODIFIER	silent_mutation	Average:22.627; most accessible tissue: Callus, score: 33.74	N	N	N	N
vg0112116426	G -> A	LOC_Os01g21620.1	downstream_gene_variant ; 2582.0bp to feature; MODIFIER	silent_mutation	Average:22.627; most accessible tissue: Callus, score: 33.74	N	N	N	N
vg0112116426	G -> A	LOC_Os01g21620-LOC_Os01g21630	intergenic_region ; MODIFIER	silent_mutation	Average:22.627; most accessible tissue: Callus, score: 33.74	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0112116426	6.25E-07	NA	Plant_height	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0112116426	NA	9.97E-16	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0112116426	2.96E-06	NA	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0112116426	NA	8.04E-07	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112116426	NA	9.03E-06	mr1149	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112116426	NA	1.11E-06	mr1991	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112116426	5.85E-07	NA	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112116426	NA	8.47E-07	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112116426	2.64E-06	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112116426	NA	3.58E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251