\
| Variant ID: vg0112116426 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 12116426 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAAAAGAAATATTAAAAGACGAGTCTAGAGTCCATATAGGAATATATATAATTTACAAATAACTAAAATTTGATATTAAAAATAATTAATAACTAACAC[G/A]
TATATAAAATATAATATGAATATTACACATTAGTTGTTTTGTAAAGTTGTTGCAAAATTTAAAATTATGTTGTCATTTTAATATATTTGAATAATATAAT
ATTATATTATTCAAATATATTAAAATGACAACATAATTTTAAATTTTGCAACAACTTTACAAAACAACTAATGTGTAATATTCATATTATATTTTATATA[C/T]
GTGTTAGTTATTAATTATTTTTAATATCAAATTTTAGTTATTTGTAAATTATATATATTCCTATATGGACTCTAGACTCGTCTTTTAATATTTCTTTTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 8.80% | 0.63% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 71.90% | 26.20% | 1.92% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 77.80% | 19.80% | 2.35% | 0.00% | NA |
| Tropical Japonica | 504 | 54.00% | 44.40% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 8.30% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 10.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0112116426 | G -> A | LOC_Os01g21630.1 | upstream_gene_variant ; 681.0bp to feature; MODIFIER | silent_mutation | Average:22.627; most accessible tissue: Callus, score: 33.74 | N | N | N | N |
| vg0112116426 | G -> A | LOC_Os01g21620.1 | downstream_gene_variant ; 2582.0bp to feature; MODIFIER | silent_mutation | Average:22.627; most accessible tissue: Callus, score: 33.74 | N | N | N | N |
| vg0112116426 | G -> A | LOC_Os01g21620-LOC_Os01g21630 | intergenic_region ; MODIFIER | silent_mutation | Average:22.627; most accessible tissue: Callus, score: 33.74 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0112116426 | 6.25E-07 | NA | Plant_height | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0112116426 | NA | 9.97E-16 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0112116426 | 2.96E-06 | NA | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0112116426 | NA | 8.04E-07 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112116426 | NA | 9.03E-06 | mr1149 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112116426 | NA | 1.11E-06 | mr1991 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112116426 | 5.85E-07 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112116426 | NA | 8.47E-07 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112116426 | 2.64E-06 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112116426 | NA | 3.58E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |