\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112115913:

Variant ID: vg0112115913 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12115913
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CTAACTAAAATTTGGAATAAACATAATAAAATTAAAAGTAAAGTTTAGAGTCCGTATAAAAATACAGTTTACAAATAATTAAATTCAAAATTAAGAAAAA[C/T]
ATGGAAAGAAGAGTTTAAGGTCAATATAAGAATACAATTTAGAAGTAATTGAAATTCAAAACTAAAAATTAAAGAATATTGAAAGATGAGTTTAGAGTCC

Reverse complement sequence

GGACTCTAAACTCATCTTTCAATATTCTTTAATTTTTAGTTTTGAATTTCAATTACTTCTAAATTGTATTCTTATATTGACCTTAAACTCTTCTTTCCAT[G/A]
TTTTTCTTAATTTTGAATTTAATTATTTGTAAACTGTATTTTTATACGGACTCTAAACTTTACTTTTAATTTTATTATGTTTATTCCAAATTTTAGTTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.80% 10.70% 0.38% 0.04% NA
All Indica  2759 83.70% 15.70% 0.51% 0.07% NA
All Japonica  1512 99.50% 0.30% 0.20% 0.00% NA
Aus  269 75.80% 24.20% 0.00% 0.00% NA
Indica I  595 97.00% 3.00% 0.00% 0.00% NA
Indica II  465 97.40% 2.40% 0.00% 0.22% NA
Indica III  913 68.90% 30.10% 0.99% 0.00% NA
Indica Intermediate  786 82.80% 16.40% 0.64% 0.13% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.20% 0.60% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112115913 C -> T LOC_Os01g21630.1 upstream_gene_variant ; 1194.0bp to feature; MODIFIER silent_mutation Average:14.104; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0112115913 C -> T LOC_Os01g21620.1 downstream_gene_variant ; 2069.0bp to feature; MODIFIER silent_mutation Average:14.104; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0112115913 C -> T LOC_Os01g21620-LOC_Os01g21630 intergenic_region ; MODIFIER silent_mutation Average:14.104; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0112115913 C -> DEL N N silent_mutation Average:14.104; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112115913 NA 6.16E-06 mr1427 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112115913 NA 4.30E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112115913 NA 3.04E-07 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112115913 NA 1.58E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112115913 NA 1.20E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112115913 NA 2.63E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251