\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112079946:

Variant ID: vg0112079946 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12079946
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTAATCAATTATTAGCAAATGTTTACTGTAGCATCACATTGTCAAATCATAGCGTAATTAGACTCAAAAGATTCGTCTCGCAATTTACATGCAAACTGT[G/A]
TAATTGGTTTTTTTCCCACATTTAATGCTACATGCATGTGTCTAAACATTTGATGCGACGTTTTTTGCCAAATTTTTTTAGATCTCAACTTTCAAACGAG

Reverse complement sequence

CTCGTTTGAAAGTTGAGATCTAAAAAAATTTGGCAAAAAACGTCGCATCAAATGTTTAGACACATGCATGTAGCATTAAATGTGGGAAAAAAACCAATTA[C/T]
ACAGTTTGCATGTAAATTGCGAGACGAATCTTTTGAGTCTAATTACGCTATGATTTGACAATGTGATGCTACAGTAAACATTTGCTAATAATTGATTAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.90% 9.40% 6.67% 2.98% NA
All Indica  2759 84.50% 0.30% 10.51% 4.68% NA
All Japonica  1512 71.00% 28.20% 0.73% 0.13% NA
Aus  269 95.20% 0.00% 2.60% 2.23% NA
Indica I  595 80.20% 0.20% 17.48% 2.18% NA
Indica II  465 72.30% 0.90% 18.71% 8.17% NA
Indica III  913 93.90% 0.10% 2.08% 3.94% NA
Indica Intermediate  786 84.10% 0.40% 10.18% 5.34% NA
Temperate Japonica  767 75.70% 23.10% 1.04% 0.13% NA
Tropical Japonica  504 53.80% 45.60% 0.40% 0.20% NA
Japonica Intermediate  241 91.70% 7.90% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 1.00% 1.04% 4.17% NA
Intermediate  90 83.30% 10.00% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112079946 G -> A LOC_Os01g21585.1 upstream_gene_variant ; 1276.0bp to feature; MODIFIER silent_mutation Average:61.11; most accessible tissue: Callus, score: 95.662 N N N N
vg0112079946 G -> A LOC_Os01g21580.1 downstream_gene_variant ; 4738.0bp to feature; MODIFIER silent_mutation Average:61.11; most accessible tissue: Callus, score: 95.662 N N N N
vg0112079946 G -> A LOC_Os01g21585-LOC_Os01g21590 intergenic_region ; MODIFIER silent_mutation Average:61.11; most accessible tissue: Callus, score: 95.662 N N N N
vg0112079946 G -> DEL N N silent_mutation Average:61.11; most accessible tissue: Callus, score: 95.662 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112079946 NA 6.16E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0112079946 NA 1.07E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112079946 NA 4.39E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112079946 NA 4.39E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112079946 1.74E-07 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112079946 NA 5.86E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112079946 1.78E-09 NA mr1107_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112079946 NA 4.07E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251