\
| Variant ID: vg0112079946 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 12079946 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATTAATCAATTATTAGCAAATGTTTACTGTAGCATCACATTGTCAAATCATAGCGTAATTAGACTCAAAAGATTCGTCTCGCAATTTACATGCAAACTGT[G/A]
TAATTGGTTTTTTTCCCACATTTAATGCTACATGCATGTGTCTAAACATTTGATGCGACGTTTTTTGCCAAATTTTTTTAGATCTCAACTTTCAAACGAG
CTCGTTTGAAAGTTGAGATCTAAAAAAATTTGGCAAAAAACGTCGCATCAAATGTTTAGACACATGCATGTAGCATTAAATGTGGGAAAAAAACCAATTA[C/T]
ACAGTTTGCATGTAAATTGCGAGACGAATCTTTTGAGTCTAATTACGCTATGATTTGACAATGTGATGCTACAGTAAACATTTGCTAATAATTGATTAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.90% | 9.40% | 6.67% | 2.98% | NA |
| All Indica | 2759 | 84.50% | 0.30% | 10.51% | 4.68% | NA |
| All Japonica | 1512 | 71.00% | 28.20% | 0.73% | 0.13% | NA |
| Aus | 269 | 95.20% | 0.00% | 2.60% | 2.23% | NA |
| Indica I | 595 | 80.20% | 0.20% | 17.48% | 2.18% | NA |
| Indica II | 465 | 72.30% | 0.90% | 18.71% | 8.17% | NA |
| Indica III | 913 | 93.90% | 0.10% | 2.08% | 3.94% | NA |
| Indica Intermediate | 786 | 84.10% | 0.40% | 10.18% | 5.34% | NA |
| Temperate Japonica | 767 | 75.70% | 23.10% | 1.04% | 0.13% | NA |
| Tropical Japonica | 504 | 53.80% | 45.60% | 0.40% | 0.20% | NA |
| Japonica Intermediate | 241 | 91.70% | 7.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 1.00% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 83.30% | 10.00% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0112079946 | G -> A | LOC_Os01g21585.1 | upstream_gene_variant ; 1276.0bp to feature; MODIFIER | silent_mutation | Average:61.11; most accessible tissue: Callus, score: 95.662 | N | N | N | N |
| vg0112079946 | G -> A | LOC_Os01g21580.1 | downstream_gene_variant ; 4738.0bp to feature; MODIFIER | silent_mutation | Average:61.11; most accessible tissue: Callus, score: 95.662 | N | N | N | N |
| vg0112079946 | G -> A | LOC_Os01g21585-LOC_Os01g21590 | intergenic_region ; MODIFIER | silent_mutation | Average:61.11; most accessible tissue: Callus, score: 95.662 | N | N | N | N |
| vg0112079946 | G -> DEL | N | N | silent_mutation | Average:61.11; most accessible tissue: Callus, score: 95.662 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0112079946 | NA | 6.16E-13 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0112079946 | NA | 1.07E-06 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112079946 | NA | 4.39E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112079946 | NA | 4.39E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112079946 | 1.74E-07 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112079946 | NA | 5.86E-07 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112079946 | 1.78E-09 | NA | mr1107_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112079946 | NA | 4.07E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |