\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112035600:

Variant ID: vg0112035600 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12035600
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGTGGCCCCCGAAGTTTCTCCCCAACCTCACAGAGAAGTATGATGGCAGCATCAATCCCTCCGAGTTCCTCCAGATCTATACCACGATCATCGTGGCAG[C/T,A]
GGGAGGGGATGACCAAATCATGGCGAATTATTTCCCCATGGCTCTTAAGGGTCAGGCGCGCGGATGGCCTATGACCCAGCCCCCCGACTCCATCCACTCC

Reverse complement sequence

GGAGTGGATGGAGTCGGGGGGCTGGGTCATAGGCCATCCGCGCGCCTGACCCTTAAGAGCCATGGGGAAATAATTCGCCATGATTTGGTCATCCCCTCCC[G/A,T]
CTGCCACGATGATCGTGGTATAGATCTGGAGGAACTCGGAGGGATTGATGCTGCCATCATACTTCTCTGTGAGGTTGGGGAGAAACTTCGGGGGCCACCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.30% 1.80% 1.27% 0.00% A: 1.65%
All Indica  2759 98.30% 1.60% 0.07% 0.00% A: 0.04%
All Japonica  1512 90.70% 0.40% 3.84% 0.00% A: 5.03%
Aus  269 88.10% 11.90% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 97.60% 2.40% 0.00% 0.00% NA
Indica Intermediate  786 97.20% 2.70% 0.00% 0.00% A: 0.13%
Temperate Japonica  767 83.10% 0.00% 7.30% 0.00% A: 9.65%
Tropical Japonica  504 98.40% 1.20% 0.40% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.00% A: 0.83%
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 0.00% 0.00% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112035600 C -> T LOC_Os01g21520.1 downstream_gene_variant ; 3346.0bp to feature; MODIFIER silent_mutation Average:78.32; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0112035600 C -> T LOC_Os01g21530.1 intron_variant ; MODIFIER silent_mutation Average:78.32; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0112035600 C -> A LOC_Os01g21520.1 downstream_gene_variant ; 3346.0bp to feature; MODIFIER silent_mutation Average:78.32; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0112035600 C -> A LOC_Os01g21530.1 intron_variant ; MODIFIER silent_mutation Average:78.32; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0112035600 C A 0.0 -0.01 -0.01 0.0 0.0 0.0
vg0112035600 C T 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112035600 NA 1.06E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112035600 NA 4.27E-06 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112035600 NA 5.69E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112035600 6.95E-06 6.95E-06 mr1440_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251