\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111972572:

Variant ID: vg0111972572 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 11972572
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.13, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


GATGAAACATGATGAAAATGGAAGACATGGACATGAAAGGTGTGATTAACGGCTGGTTTGGTTTGTAGCCTAAATTGGCCTTACCAATATTTGGCAATTT[C/T]
AATAGTGTTTAGTGACTTTGAAGTTAAATTTTGGTATGCCTAAAAAAATAAGTCATTTCAATAGTTAGCTTAGGCTATTTTGGTTTCAACCCAACACAAT

Reverse complement sequence

ATTGTGTTGGGTTGAAACCAAAATAGCCTAAGCTAACTATTGAAATGACTTATTTTTTTAGGCATACCAAAATTTAACTTCAAAGTCACTAAACACTATT[G/A]
AAATTGCCAAATATTGGTAAGGCCAATTTAGGCTACAAACCAAACCAGCCGTTAATCACACCTTTCATGTCCATGTCTTCCATTTTCATCATGTTTCATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 36.50% 0.30% 0.00% NA
All Indica  2759 76.50% 23.10% 0.47% 0.00% NA
All Japonica  1512 34.30% 65.70% 0.00% 0.00% NA
Aus  269 83.60% 16.40% 0.00% 0.00% NA
Indica I  595 85.40% 14.50% 0.17% 0.00% NA
Indica II  465 92.30% 7.50% 0.22% 0.00% NA
Indica III  913 66.70% 32.50% 0.77% 0.00% NA
Indica Intermediate  786 71.80% 27.70% 0.51% 0.00% NA
Temperate Japonica  767 28.60% 71.40% 0.00% 0.00% NA
Tropical Japonica  504 48.40% 51.60% 0.00% 0.00% NA
Japonica Intermediate  241 23.20% 76.80% 0.00% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 65.60% 33.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0111972572 C -> T LOC_Os01g21450.1 upstream_gene_variant ; 2085.0bp to feature; MODIFIER silent_mutation Average:60.789; most accessible tissue: Callus, score: 84.655 N N N N
vg0111972572 C -> T LOC_Os01g21450.3 upstream_gene_variant ; 1557.0bp to feature; MODIFIER silent_mutation Average:60.789; most accessible tissue: Callus, score: 84.655 N N N N
vg0111972572 C -> T LOC_Os01g21450.2 upstream_gene_variant ; 1871.0bp to feature; MODIFIER silent_mutation Average:60.789; most accessible tissue: Callus, score: 84.655 N N N N
vg0111972572 C -> T LOC_Os01g21430.1 downstream_gene_variant ; 3875.0bp to feature; MODIFIER silent_mutation Average:60.789; most accessible tissue: Callus, score: 84.655 N N N N
vg0111972572 C -> T LOC_Os01g21440.1 downstream_gene_variant ; 4.0bp to feature; MODIFIER silent_mutation Average:60.789; most accessible tissue: Callus, score: 84.655 N N N N
vg0111972572 C -> T LOC_Os01g21440.2 downstream_gene_variant ; 4.0bp to feature; MODIFIER silent_mutation Average:60.789; most accessible tissue: Callus, score: 84.655 N N N N
vg0111972572 C -> T LOC_Os01g21440-LOC_Os01g21450 intergenic_region ; MODIFIER silent_mutation Average:60.789; most accessible tissue: Callus, score: 84.655 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0111972572 NA 1.56E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0111972572 NA 4.83E-06 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572 NA 2.59E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572 NA 1.59E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572 NA 7.32E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572 NA 5.89E-08 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572 NA 9.00E-07 mr1263 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572 NA 9.00E-07 mr1451 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572 NA 2.57E-06 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572 NA 4.32E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572 NA 3.44E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572 2.92E-06 2.92E-06 mr1797 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572 2.92E-06 2.92E-06 mr1801 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572 NA 4.85E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572 NA 8.20E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572 NA 4.41E-09 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572 NA 3.84E-06 mr1553_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572 NA 2.13E-11 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572 NA 3.43E-06 mr1788_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251