Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111972572:

Variant ID: vg0111972572 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 11972572
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.13, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

GATGAAACATGATGAAAATGGAAGACATGGACATGAAAGGTGTGATTAACGGCTGGTTTGGTTTGTAGCCTAAATTGGCCTTACCAATATTTGGCAATTT[C/T]
AATAGTGTTTAGTGACTTTGAAGTTAAATTTTGGTATGCCTAAAAAAATAAGTCATTTCAATAGTTAGCTTAGGCTATTTTGGTTTCAACCCAACACAAT

Reverse complement sequence

ATTGTGTTGGGTTGAAACCAAAATAGCCTAAGCTAACTATTGAAATGACTTATTTTTTTAGGCATACCAAAATTTAACTTCAAAGTCACTAAACACTATT[G/A]
AAATTGCCAAATATTGGTAAGGCCAATTTAGGCTACAAACCAAACCAGCCGTTAATCACACCTTTCATGTCCATGTCTTCCATTTTCATCATGTTTCATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.20%	36.50%	0.30%	0.00%	NA
All Indica	2759	76.50%	23.10%	0.47%	0.00%	NA
All Japonica	1512	34.30%	65.70%	0.00%	0.00%	NA
Aus	269	83.60%	16.40%	0.00%	0.00%	NA
Indica I	595	85.40%	14.50%	0.17%	0.00%	NA
Indica II	465	92.30%	7.50%	0.22%	0.00%	NA
Indica III	913	66.70%	32.50%	0.77%	0.00%	NA
Indica Intermediate	786	71.80%	27.70%	0.51%	0.00%	NA
Temperate Japonica	767	28.60%	71.40%	0.00%	0.00%	NA
Tropical Japonica	504	48.40%	51.60%	0.00%	0.00%	NA
Japonica Intermediate	241	23.20%	76.80%	0.00%	0.00%	NA
VI/Aromatic	96	77.10%	22.90%	0.00%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0111972572	C -> T	LOC_Os01g21450.1	upstream_gene_variant ; 2085.0bp to feature; MODIFIER	silent_mutation	Average:60.789; most accessible tissue: Callus, score: 84.655	N	N	N	N
vg0111972572	C -> T	LOC_Os01g21450.3	upstream_gene_variant ; 1557.0bp to feature; MODIFIER	silent_mutation	Average:60.789; most accessible tissue: Callus, score: 84.655	N	N	N	N
vg0111972572	C -> T	LOC_Os01g21450.2	upstream_gene_variant ; 1871.0bp to feature; MODIFIER	silent_mutation	Average:60.789; most accessible tissue: Callus, score: 84.655	N	N	N	N
vg0111972572	C -> T	LOC_Os01g21430.1	downstream_gene_variant ; 3875.0bp to feature; MODIFIER	silent_mutation	Average:60.789; most accessible tissue: Callus, score: 84.655	N	N	N	N
vg0111972572	C -> T	LOC_Os01g21440.1	downstream_gene_variant ; 4.0bp to feature; MODIFIER	silent_mutation	Average:60.789; most accessible tissue: Callus, score: 84.655	N	N	N	N
vg0111972572	C -> T	LOC_Os01g21440.2	downstream_gene_variant ; 4.0bp to feature; MODIFIER	silent_mutation	Average:60.789; most accessible tissue: Callus, score: 84.655	N	N	N	N
vg0111972572	C -> T	LOC_Os01g21440-LOC_Os01g21450	intergenic_region ; MODIFIER	silent_mutation	Average:60.789; most accessible tissue: Callus, score: 84.655	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0111972572	NA	1.56E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0111972572	NA	4.83E-06	mr1028	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572	NA	2.59E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572	NA	1.59E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572	NA	7.32E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572	NA	5.89E-08	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572	NA	9.00E-07	mr1263	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572	NA	9.00E-07	mr1451	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572	NA	2.57E-06	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572	NA	4.32E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572	NA	3.44E-06	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572	2.92E-06	2.92E-06	mr1797	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572	2.92E-06	2.92E-06	mr1801	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572	NA	4.85E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572	NA	8.20E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572	NA	4.41E-09	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572	NA	3.84E-06	mr1553_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572	NA	2.13E-11	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111972572	NA	3.43E-06	mr1788_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251