\
| Variant ID: vg0111937994 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 11937994 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, C: 0.14, others allele: 0.00, population size: 99. )
CCACCGCTCAACCACGAAGCCACCGCACGCCCCCTTCGTCAAGGGGTGGGCAAGGCGAGAGCCGGCCCACAGAGAGGACTACCCAAGCCTCGATCACTAG[C/G]
GTAGTTCTTCCTTCACTCCGAAGGTGGTGAACTCCAAACCACTCACAAACCGGCGCCGGGCCTCTTCCATAATCTTCTCGGAGAGGTCACTGGGCAACTC
GAGTTGCCCAGTGACCTCTCCGAGAAGATTATGGAAGAGGCCCGGCGCCGGTTTGTGAGTGGTTTGGAGTTCACCACCTTCGGAGTGAAGGAAGAACTAC[G/C]
CTAGTGATCGAGGCTTGGGTAGTCCTCTCTGTGGGCCGGCTCTCGCCTTGCCCACCCCTTGACGAAGGGGGCGTGCGGTGGCTTCGTGGTTGAGCGGTGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.60% | 22.20% | 5.56% | 0.72% | NA |
| All Indica | 2759 | 91.30% | 1.30% | 7.21% | 0.18% | NA |
| All Japonica | 1512 | 33.60% | 64.00% | 0.46% | 1.92% | NA |
| Aus | 269 | 84.80% | 0.70% | 14.50% | 0.00% | NA |
| Indica I | 595 | 92.60% | 0.70% | 6.55% | 0.17% | NA |
| Indica II | 465 | 90.80% | 2.60% | 6.24% | 0.43% | NA |
| Indica III | 913 | 93.30% | 0.40% | 6.24% | 0.00% | NA |
| Indica Intermediate | 786 | 88.30% | 2.00% | 9.41% | 0.25% | NA |
| Temperate Japonica | 767 | 27.90% | 72.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 47.20% | 45.80% | 1.19% | 5.75% | NA |
| Japonica Intermediate | 241 | 23.20% | 76.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 66.70% | 21.90% | 11.46% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 22.20% | 7.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0111937994 | C -> G | LOC_Os01g21360.1 | upstream_gene_variant ; 509.0bp to feature; MODIFIER | silent_mutation | Average:39.612; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0111937994 | C -> G | LOC_Os01g21360-LOC_Os01g21380 | intergenic_region ; MODIFIER | silent_mutation | Average:39.612; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0111937994 | C -> DEL | N | N | silent_mutation | Average:39.612; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0111937994 | NA | 6.56E-12 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0111937994 | NA | 1.72E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111937994 | NA | 2.31E-16 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111937994 | NA | 7.13E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111937994 | NA | 3.13E-07 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111937994 | NA | 9.34E-06 | mr1263 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111937994 | NA | 9.34E-06 | mr1451 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111937994 | NA | 7.68E-09 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111937994 | NA | 5.91E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111937994 | NA | 5.35E-17 | mr1740 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111937994 | NA | 4.75E-06 | mr1740 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111937994 | NA | 2.79E-12 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111937994 | NA | 1.29E-20 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111937994 | NA | 2.13E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111937994 | NA | 7.84E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111937994 | NA | 1.14E-09 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111937994 | NA | 3.39E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111937994 | NA | 8.47E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111937994 | NA | 1.19E-09 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |