\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111928641:

Variant ID: vg0111928641 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 11928641
Reference Allele: CAlternative Allele: T,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GAGACAAGAGATTTTTCACCGAGGTTCGGAAACTCGCTGGTTTCCTACTCCCTGTTGAGGCGAGCCCAACTCCACCGCTCAACCACAAAGCCACCGCACG[C/T,G]
CCCCTTCGTCAAGGGGTGGGCAAGGCGGGAGCCGGCCCACGGAGAGGACTACCCAAGCCTCGATCACTAGGGTAGTTCTTCCTTCACTCCGAAGGTGGTG

Reverse complement sequence

CACCACCTTCGGAGTGAAGGAAGAACTACCCTAGTGATCGAGGCTTGGGTAGTCCTCTCCGTGGGCCGGCTCCCGCCTTGCCCACCCCTTGACGAAGGGG[G/A,C]
CGTGCGGTGGCTTTGTGGTTGAGCGGTGGAGTTGGGCTCGCCTCAACAGGGAGTAGGAAACCAGCGAGTTTCCGAACCTCGGTGAAAAATCTCTTGTCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.00% 9.90% 0.02% 0.00% G: 0.02%
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 70.10% 29.80% 0.00% 0.00% G: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 74.40% 25.60% 0.00% 0.00% NA
Tropical Japonica  504 59.10% 40.70% 0.00% 0.00% G: 0.20%
Japonica Intermediate  241 79.30% 20.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0111928641 C -> G LOC_Os01g21350.1 downstream_gene_variant ; 1712.0bp to feature; MODIFIER silent_mutation Average:36.769; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg0111928641 C -> G LOC_Os01g21340-LOC_Os01g21350 intergenic_region ; MODIFIER silent_mutation Average:36.769; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg0111928641 C -> T LOC_Os01g21350.1 downstream_gene_variant ; 1712.0bp to feature; MODIFIER silent_mutation Average:36.769; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg0111928641 C -> T LOC_Os01g21340-LOC_Os01g21350 intergenic_region ; MODIFIER silent_mutation Average:36.769; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0111928641 NA 5.81E-08 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 2.48E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 7.02E-08 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 3.60E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 2.32E-07 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 1.18E-07 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 7.59E-08 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 5.22E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 1.85E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 1.11E-06 mr1492 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 3.46E-08 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 8.60E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 8.07E-06 mr1773 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 1.79E-06 5.21E-11 mr1797 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 5.75E-06 5.75E-06 mr1797 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 1.79E-06 5.21E-11 mr1801 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 5.75E-06 5.75E-06 mr1801 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 1.55E-06 mr1802 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 1.29E-06 mr1812 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 4.35E-07 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 3.26E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 1.21E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 3.46E-06 mr1991 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 5.08E-07 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 2.00E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111928641 NA 2.41E-09 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251