Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0111860182:

Variant ID: vg0111860182 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 11860182
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.50, A: 0.50, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGAGGGGGTCCGATAGAACCGAAATATCGTTCCGAAATTTAGAACCTGAGCTGGACTACAAATTTCAGAGCACTCCAAACAAAGGGGAAAGAGAAATG[A/C]
GCAAACGTTCCTCGCAAGGAAAAAAAAAAGAAAGAAAGAAAGGAAAGGAAATTAAGAGAAAGAAAACGAAATGAGCACACGCGTATTTAATTTTCTCTGC

Reverse complement sequence

GCAGAGAAAATTAAATACGCGTGTGCTCATTTCGTTTTCTTTCTCTTAATTTCCTTTCCTTTCTTTCTTTCTTTTTTTTTTCCTTGCGAGGAACGTTTGC[T/G]
CATTTCTCTTTCCCCTTTGTTTGGAGTGCTCTGAAATTTGTAGTCCAGCTCAGGTTCTAAATTTCGGAACGATATTTCGGTTCTATCGGACCCCCTCGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.70% 33.30% 0.00% 0.00% NA
All Indica  2759 98.20% 1.80% 0.00% 0.00% NA
All Japonica  1512 4.00% 96.00% 0.00% 0.00% NA
Aus  269 93.30% 6.70% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 97.10% 2.90% 0.00% 0.00% NA
Temperate Japonica  767 2.60% 97.40% 0.00% 0.00% NA
Tropical Japonica  504 6.70% 93.30% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0111860182 A -> C LOC_Os01g21240.1 downstream_gene_variant ; 1208.0bp to feature; MODIFIER silent_mutation Average:84.933; most accessible tissue: Callus, score: 97.156 N N N N
vg0111860182 A -> C LOC_Os01g21250.1 downstream_gene_variant ; 3738.0bp to feature; MODIFIER silent_mutation Average:84.933; most accessible tissue: Callus, score: 97.156 N N N N
vg0111860182 A -> C LOC_Os01g21240-LOC_Os01g21250 intergenic_region ; MODIFIER silent_mutation Average:84.933; most accessible tissue: Callus, score: 97.156 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0111860182 A C 0.06 0.07 0.07 0.02 0.08 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0111860182 NA 1.36E-55 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111860182 NA 2.64E-67 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111860182 NA 1.32E-86 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111860182 NA 7.21E-87 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111860182 NA 7.38E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111860182 NA 2.92E-87 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111860182 NA 2.32E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111860182 NA 5.69E-59 mr1711 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111860182 NA 8.77E-94 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111860182 NA 3.96E-21 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111860182 NA 2.58E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111860182 NA 5.28E-104 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111860182 NA 2.31E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111860182 NA 1.31E-63 mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111860182 6.72E-07 4.76E-135 mr1758_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111860182 3.73E-06 NA mr1987_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251