\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111846225:

Variant ID: vg0111846225 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 11846225
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.26, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CATGAAAAAAATCGTAGCATCAATGTTAAAATTATTGCAATAGATACATATTGCCACAATCTTAAAATCGTTGCTAGCCGTGGTAATAGGTTATTGCAAC[G/A]
ATTTTTATTTAGTTGTAATAAATTTTGTTATTGCCATAAAATGTATGTGGCAAAAAATATATATTGCAACACTTCACATCGTTGCAATAAATAACTATTG

Reverse complement sequence

CAATAGTTATTTATTGCAACGATGTGAAGTGTTGCAATATATATTTTTTGCCACATACATTTTATGGCAATAACAAAATTTATTACAACTAAATAAAAAT[C/T]
GTTGCAATAACCTATTACCACGGCTAGCAACGATTTTAAGATTGTGGCAATATGTATCTATTGCAATAATTTTAACATTGATGCTACGATTTTTTTCATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 35.20% 0.28% 0.59% NA
All Indica  2759 95.70% 2.90% 0.40% 1.01% NA
All Japonica  1512 3.40% 96.60% 0.00% 0.00% NA
Aus  269 76.20% 23.80% 0.00% 0.00% NA
Indica I  595 97.50% 0.70% 1.01% 0.84% NA
Indica II  465 94.40% 4.10% 0.22% 1.29% NA
Indica III  913 96.50% 2.10% 0.11% 1.31% NA
Indica Intermediate  786 94.30% 4.70% 0.38% 0.64% NA
Temperate Japonica  767 2.20% 97.80% 0.00% 0.00% NA
Tropical Japonica  504 5.40% 94.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 56.70% 41.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0111846225 G -> A LOC_Os01g21220.1 upstream_gene_variant ; 2991.0bp to feature; MODIFIER silent_mutation Average:43.639; most accessible tissue: Callus, score: 59.784 N N N N
vg0111846225 G -> A LOC_Os01g21220-LOC_Os01g21240 intergenic_region ; MODIFIER silent_mutation Average:43.639; most accessible tissue: Callus, score: 59.784 N N N N
vg0111846225 G -> DEL N N silent_mutation Average:43.639; most accessible tissue: Callus, score: 59.784 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0111846225 5.08E-06 3.69E-14 mr1454_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251