\
| Variant ID: vg0111834681 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 11834681 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.24, others allele: 0.00, population size: 236. )
AAGAGAGAAAAAGGCCGAAGAGCAAAGGGATAAAAGGTTCAATGAGTTGCGACCACCACCGGTATGGAGGCGTAAAACCATAGAGAAGGGAGAACCGGTT[A/G]
TTGTAGAGAAGAAGGAAGAACAATCGGTTGCTAAAGATGAGTCATCTCCAAAAGTAGACATGGATATCAACATGGTATGTATGTTGCCTATGGAGTTTTG
CAAAACTCCATAGGCAACATACATACCATGTTGATATCCATGTCTACTTTTGGAGATGACTCATCTTTAGCAACCGATTGTTCTTCCTTCTTCTCTACAA[T/C]
AACCGGTTCTCCCTTCTCTATGGTTTTACGCCTCCATACCGGTGGTGGTCGCAACTCATTGAACCTTTTATCCCTTTGCTCTTCGGCCTTTTTCTCTCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.50% | 32.60% | 0.72% | 0.11% | NA |
| All Indica | 2759 | 98.00% | 1.30% | 0.62% | 0.07% | NA |
| All Japonica | 1512 | 4.00% | 96.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 92.20% | 0.70% | 5.95% | 1.12% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 2.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.80% | 0.30% | 0.77% | 0.11% | NA |
| Indica Intermediate | 786 | 96.90% | 1.80% | 1.15% | 0.13% | NA |
| Temperate Japonica | 767 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 36.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0111834681 | A -> G | LOC_Os01g21210.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.926; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| vg0111834681 | A -> DEL | N | N | silent_mutation | Average:39.926; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0111834681 | NA | 5.96E-67 | mr1027 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111834681 | NA | 1.58E-49 | mr1154 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111834681 | NA | 9.27E-85 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111834681 | NA | 4.76E-90 | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111834681 | NA | 2.00E-56 | mr1594 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111834681 | NA | 2.12E-87 | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111834681 | NA | 1.16E-59 | mr1711 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111834681 | NA | 6.94E-33 | mr1733 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111834681 | NA | 3.23E-93 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111834681 | NA | 2.39E-20 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111834681 | NA | 6.00E-39 | mr1891 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111834681 | NA | 9.07E-16 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111834681 | 1.36E-06 | 1.51E-102 | mr1987 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111834681 | NA | 2.61E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111834681 | NA | 7.70E-24 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111834681 | NA | 2.16E-64 | mr1733_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |