\
| Variant ID: vg0111822580 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 11822580 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 268. )
TAGTATCTGGCCCCGATACTTTTCAGTCAAGAATTTCCCATCAATGCAGAGAACAGGACGACAGTTCACGAATGCCATCTTGCATGCATGTAGAGCTAAG[T/A]
ACGCCCTTTGCAGCACACTCTTGCCAGGATGTTCAATTGAGGGGAATTTCTTCACTGCGTAAGAGCTCCCAGGGTTTCTTTCTTCGATAACACCAAGCAG
CTGCTTGGTGTTATCGAAGAAAGAAACCCTGGGAGCTCTTACGCAGTGAAGAAATTCCCCTCAATTGAACATCCTGGCAAGAGTGTGCTGCAAAGGGCGT[A/T]
CTTAGCTCTACATGCATGCAAGATGGCATTCGTGAACTGTCGTCCTGTTCTCTGCATTGATGGGAAATTCTTGACTGAAAAGTATCGGGGCCAGATACTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.30% | 22.80% | 19.81% | 3.11% | NA |
| All Indica | 2759 | 63.50% | 2.20% | 30.77% | 3.48% | NA |
| All Japonica | 1512 | 34.00% | 64.70% | 1.12% | 0.13% | NA |
| Aus | 269 | 69.90% | 0.70% | 12.27% | 17.10% | NA |
| Indica I | 595 | 49.20% | 1.80% | 43.19% | 5.71% | NA |
| Indica II | 465 | 57.20% | 3.90% | 34.19% | 4.73% | NA |
| Indica III | 913 | 77.40% | 1.00% | 20.48% | 1.10% | NA |
| Indica Intermediate | 786 | 61.80% | 3.10% | 31.30% | 3.82% | NA |
| Temperate Japonica | 767 | 28.30% | 70.90% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 47.00% | 51.00% | 1.79% | 0.20% | NA |
| Japonica Intermediate | 241 | 24.90% | 73.90% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 72.90% | 7.30% | 18.75% | 1.04% | NA |
| Intermediate | 90 | 46.70% | 30.00% | 21.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0111822580 | T -> A | LOC_Os01g21200.1 | downstream_gene_variant ; 2582.0bp to feature; MODIFIER | silent_mutation | Average:13.504; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0111822580 | T -> A | LOC_Os01g21190.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.504; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0111822580 | T -> DEL | N | N | silent_mutation | Average:13.504; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0111822580 | NA | 2.36E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111822580 | NA | 4.39E-22 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111822580 | NA | 1.03E-21 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111822580 | NA | 1.17E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111822580 | NA | 5.58E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111822580 | NA | 6.30E-06 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111822580 | 8.04E-08 | 1.48E-06 | mr1400_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111822580 | 7.94E-07 | 7.94E-07 | mr1400_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111822580 | NA | 3.46E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111822580 | NA | 5.22E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111822580 | NA | 5.30E-09 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111822580 | NA | 2.77E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |