\
| Variant ID: vg0111818505 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 11818505 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAATCGGATGAATCGGCTCACATAGATGTGCGAGGCATGTACAAAAAAATCCTTAAAAATACTTACCTCCGTGCGGAGGGGGAGTCGGCCTAGGAACGTG[C/T]
GCAGCTGGATGGGGACAAGTCGGTACGGGCGGCCGCTGTACAGCTGCGTCTGCCCGAGCAACGTCGTCTGCACGACAGGTGAGCACTCGGAGAATCGAGC
GCTCGATTCTCCGAGTGCTCACCTGTCGTGCAGACGACGTTGCTCGGGCAGACGCAGCTGTACAGCGGCCGCCCGTACCGACTTGTCCCCATCCAGCTGC[G/A]
CACGTTCCTAGGCCGACTCCCCCTCCGCACGGAGGTAAGTATTTTTAAGGATTTTTTTGTACATGCCTCGCACATCTATGTGAGCCGATTCATCCGATTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.70% | 10.60% | 4.70% | 1.04% | NA |
| All Indica | 2759 | 91.60% | 0.30% | 6.60% | 1.52% | NA |
| All Japonica | 1512 | 68.40% | 31.20% | 0.13% | 0.33% | NA |
| Aus | 269 | 86.60% | 0.00% | 13.38% | 0.00% | NA |
| Indica I | 595 | 90.80% | 0.20% | 7.73% | 1.34% | NA |
| Indica II | 465 | 97.20% | 0.00% | 1.72% | 1.08% | NA |
| Indica III | 913 | 92.70% | 0.20% | 5.59% | 1.53% | NA |
| Indica Intermediate | 786 | 87.70% | 0.60% | 9.80% | 1.91% | NA |
| Temperate Japonica | 767 | 72.80% | 26.60% | 0.13% | 0.52% | NA |
| Tropical Japonica | 504 | 57.70% | 41.90% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 76.80% | 23.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 7.80% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0111818505 | C -> T | LOC_Os01g21190.1 | missense_variant ; p.Arg1021His; MODERATE | nonsynonymous_codon ; R1021H | Average:51.477; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 | possibly damaging |
1.872 |
DELETERIOUS | 0.03 |
| vg0111818505 | C -> DEL | LOC_Os01g21190.1 | N | frameshift_variant | Average:51.477; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0111818505 | NA | 1.97E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111818505 | NA | 2.96E-06 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111818505 | 3.73E-06 | 7.90E-07 | mr1470 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111818505 | NA | 9.89E-08 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111818505 | NA | 9.89E-08 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111818505 | NA | 6.32E-06 | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111818505 | NA | 1.75E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111818505 | 1.56E-07 | NA | mr1400_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111818505 | 6.35E-07 | 6.35E-07 | mr1400_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111818505 | NA | 4.34E-08 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111818505 | NA | 6.44E-10 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111818505 | NA | 5.35E-06 | mr1715_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |