Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111811184:

Variant ID: vg0111811184 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 11811184
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

GGGTGACAAATCAACCAATGGATGTATATGATATTGTTTTCCATACCCTTCAACCGCTTAAGAGACAAATCAAGAGTAAAAATCAACTAAGTCAGTAACC[G/A]
TGGGCCTAAAACCTGGGAAACAAAAGAGGATGGGAAACTACAGCAACAAAAAAATGTGTTAGAGAGTCAAACTGGGTAAATAATGCTACTATATCCTAAA

Reverse complement sequence

TTTAGGATATAGTAGCATTATTTACCCAGTTTGACTCTCTAACACATTTTTTTGTTGCTGTAGTTTCCCATCCTCTTTTGTTTCCCAGGTTTTAGGCCCA[C/T]
GGTTACTGACTTAGTTGATTTTTACTCTTGATTTGTCTCTTAAGCGGTTGAAGGGTATGGAAAACAATATCATATACATCCATTGGTTGATTTGTCACCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.10%	21.80%	0.08%	0.00%	NA
All Indica	2759	98.90%	1.10%	0.00%	0.00%	NA
All Japonica	1512	35.70%	64.10%	0.20%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.70%	0.00%	0.00%	NA
Temperate Japonica	767	29.90%	69.80%	0.39%	0.00%	NA
Tropical Japonica	504	49.20%	50.80%	0.00%	0.00%	NA
Japonica Intermediate	241	26.10%	73.90%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	72.20%	26.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0111811184	G -> A	LOC_Os01g21170.1	5_prime_UTR_premature_start_codon_gain_variant ; LOW	silent_mutation	Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755	N	N	N	N
vg0111811184	G -> A	LOC_Os01g21170.1	5_prime_UTR_variant ; 438.0bp to feature; MODIFIER	silent_mutation	Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755	N	N	N	N
vg0111811184	G -> A	LOC_Os01g21160.1	upstream_gene_variant ; 2123.0bp to feature; MODIFIER	silent_mutation	Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755	N	N	N	N
vg0111811184	G -> A	LOC_Os01g21160.2	upstream_gene_variant ; 2635.0bp to feature; MODIFIER	silent_mutation	Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755	N	N	N	N
vg0111811184	G -> A	LOC_Os01g21160.4	upstream_gene_variant ; 2150.0bp to feature; MODIFIER	silent_mutation	Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755	N	N	N	N
vg0111811184	G -> A	LOC_Os01g21160.3	upstream_gene_variant ; 2123.0bp to feature; MODIFIER	silent_mutation	Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755	N	N	N	N
vg0111811184	G -> A	LOC_Os01g21180.1	downstream_gene_variant ; 994.0bp to feature; MODIFIER	silent_mutation	Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755	N	N	N	N
vg0111811184	G -> A	LOC_Os01g21180.2	downstream_gene_variant ; 994.0bp to feature; MODIFIER	silent_mutation	Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0111811184	NA	4.76E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184	NA	1.24E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184	NA	9.15E-22	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184	NA	3.73E-22	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184	NA	6.41E-09	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184	NA	7.60E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184	NA	2.01E-06	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184	NA	4.52E-06	mr1296_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184	NA	6.75E-07	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184	7.04E-08	1.28E-06	mr1400_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184	6.13E-07	6.13E-07	mr1400_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184	NA	1.82E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184	NA	4.89E-09	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184	NA	8.82E-09	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184	NA	4.29E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184	NA	1.79E-08	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184	NA	2.98E-08	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251