\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111811184:

Variant ID: vg0111811184 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 11811184
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTGACAAATCAACCAATGGATGTATATGATATTGTTTTCCATACCCTTCAACCGCTTAAGAGACAAATCAAGAGTAAAAATCAACTAAGTCAGTAACC[G/A]
TGGGCCTAAAACCTGGGAAACAAAAGAGGATGGGAAACTACAGCAACAAAAAAATGTGTTAGAGAGTCAAACTGGGTAAATAATGCTACTATATCCTAAA

Reverse complement sequence

TTTAGGATATAGTAGCATTATTTACCCAGTTTGACTCTCTAACACATTTTTTTGTTGCTGTAGTTTCCCATCCTCTTTTGTTTCCCAGGTTTTAGGCCCA[C/T]
GGTTACTGACTTAGTTGATTTTTACTCTTGATTTGTCTCTTAAGCGGTTGAAGGGTATGGAAAACAATATCATATACATCCATTGGTTGATTTGTCACCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.10% 21.80% 0.08% 0.00% NA
All Indica  2759 98.90% 1.10% 0.00% 0.00% NA
All Japonica  1512 35.70% 64.10% 0.20% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 29.90% 69.80% 0.39% 0.00% NA
Tropical Japonica  504 49.20% 50.80% 0.00% 0.00% NA
Japonica Intermediate  241 26.10% 73.90% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 72.20% 26.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0111811184 G -> A LOC_Os01g21170.1 5_prime_UTR_premature_start_codon_gain_variant ; LOW silent_mutation Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0111811184 G -> A LOC_Os01g21170.1 5_prime_UTR_variant ; 438.0bp to feature; MODIFIER silent_mutation Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0111811184 G -> A LOC_Os01g21160.1 upstream_gene_variant ; 2123.0bp to feature; MODIFIER silent_mutation Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0111811184 G -> A LOC_Os01g21160.2 upstream_gene_variant ; 2635.0bp to feature; MODIFIER silent_mutation Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0111811184 G -> A LOC_Os01g21160.4 upstream_gene_variant ; 2150.0bp to feature; MODIFIER silent_mutation Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0111811184 G -> A LOC_Os01g21160.3 upstream_gene_variant ; 2123.0bp to feature; MODIFIER silent_mutation Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0111811184 G -> A LOC_Os01g21180.1 downstream_gene_variant ; 994.0bp to feature; MODIFIER silent_mutation Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0111811184 G -> A LOC_Os01g21180.2 downstream_gene_variant ; 994.0bp to feature; MODIFIER silent_mutation Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0111811184 NA 4.76E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184 NA 1.24E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184 NA 9.15E-22 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184 NA 3.73E-22 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184 NA 6.41E-09 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184 NA 7.60E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184 NA 2.01E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184 NA 4.52E-06 mr1296_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184 NA 6.75E-07 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184 7.04E-08 1.28E-06 mr1400_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184 6.13E-07 6.13E-07 mr1400_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184 NA 1.82E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184 NA 4.89E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184 NA 8.82E-09 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184 NA 4.29E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184 NA 1.79E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111811184 NA 2.98E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251