\
| Variant ID: vg0111811184 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 11811184 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 277. )
GGGTGACAAATCAACCAATGGATGTATATGATATTGTTTTCCATACCCTTCAACCGCTTAAGAGACAAATCAAGAGTAAAAATCAACTAAGTCAGTAACC[G/A]
TGGGCCTAAAACCTGGGAAACAAAAGAGGATGGGAAACTACAGCAACAAAAAAATGTGTTAGAGAGTCAAACTGGGTAAATAATGCTACTATATCCTAAA
TTTAGGATATAGTAGCATTATTTACCCAGTTTGACTCTCTAACACATTTTTTTGTTGCTGTAGTTTCCCATCCTCTTTTGTTTCCCAGGTTTTAGGCCCA[C/T]
GGTTACTGACTTAGTTGATTTTTACTCTTGATTTGTCTCTTAAGCGGTTGAAGGGTATGGAAAACAATATCATATACATCCATTGGTTGATTTGTCACCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.10% | 21.80% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 35.70% | 64.10% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 29.90% | 69.80% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 49.20% | 50.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 26.10% | 73.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 26.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0111811184 | G -> A | LOC_Os01g21170.1 | 5_prime_UTR_premature_start_codon_gain_variant ; LOW | silent_mutation | Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0111811184 | G -> A | LOC_Os01g21170.1 | 5_prime_UTR_variant ; 438.0bp to feature; MODIFIER | silent_mutation | Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0111811184 | G -> A | LOC_Os01g21160.1 | upstream_gene_variant ; 2123.0bp to feature; MODIFIER | silent_mutation | Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0111811184 | G -> A | LOC_Os01g21160.2 | upstream_gene_variant ; 2635.0bp to feature; MODIFIER | silent_mutation | Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0111811184 | G -> A | LOC_Os01g21160.4 | upstream_gene_variant ; 2150.0bp to feature; MODIFIER | silent_mutation | Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0111811184 | G -> A | LOC_Os01g21160.3 | upstream_gene_variant ; 2123.0bp to feature; MODIFIER | silent_mutation | Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0111811184 | G -> A | LOC_Os01g21180.1 | downstream_gene_variant ; 994.0bp to feature; MODIFIER | silent_mutation | Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0111811184 | G -> A | LOC_Os01g21180.2 | downstream_gene_variant ; 994.0bp to feature; MODIFIER | silent_mutation | Average:42.697; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0111811184 | NA | 4.76E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111811184 | NA | 1.24E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111811184 | NA | 9.15E-22 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111811184 | NA | 3.73E-22 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111811184 | NA | 6.41E-09 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111811184 | NA | 7.60E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111811184 | NA | 2.01E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111811184 | NA | 4.52E-06 | mr1296_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111811184 | NA | 6.75E-07 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111811184 | 7.04E-08 | 1.28E-06 | mr1400_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111811184 | 6.13E-07 | 6.13E-07 | mr1400_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111811184 | NA | 1.82E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111811184 | NA | 4.89E-09 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111811184 | NA | 8.82E-09 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111811184 | NA | 4.29E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111811184 | NA | 1.79E-08 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111811184 | NA | 2.98E-08 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |