\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111793207:

Variant ID: vg0111793207 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 11793207
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, T: 0.32, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GATGGGAACAGCGAGCGTCTGGGCGTCGCCGATACGGTGGACGAGATGGCCTCCTGGTTGACGATGGCTCTGATCCATCAGGATGGCATGGGCGGCTCAA[T/C]
GACTTGACGACGTCCACGGATGCGGGTAGCTCGGCGACATTCCGGCAGTTCGAATGAGACTTCTATCAGGCACGGCTCAGTAGTAACCATGCTTGCTCCG

Reverse complement sequence

CGGAGCAAGCATGGTTACTACTGAGCCGTGCCTGATAGAAGTCTCATTCGAACTGCCGGAATGTCGCCGAGCTACCCGCATCCGTGGACGTCGTCAAGTC[A/G]
TTGAGCCGCCCATGCCATCCTGATGGATCAGAGCCATCGTCAACCAGGAGGCCATCTCGTCCACCGTATCGGCGACGCCCAGACGCTCGCTGTTCCCATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.50% 33.90% 1.88% 14.73% NA
All Indica  2759 69.80% 2.50% 3.01% 24.68% NA
All Japonica  1512 3.80% 96.10% 0.07% 0.07% NA
Aus  269 91.40% 7.80% 0.37% 0.37% NA
Indica I  595 90.60% 0.70% 1.68% 7.06% NA
Indica II  465 48.20% 4.50% 6.67% 40.65% NA
Indica III  913 67.00% 2.00% 1.97% 29.03% NA
Indica Intermediate  786 70.00% 3.40% 3.05% 23.54% NA
Temperate Japonica  767 2.00% 97.80% 0.13% 0.13% NA
Tropical Japonica  504 6.90% 93.10% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 42.20% 38.90% 4.44% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0111793207 T -> DEL N N silent_mutation Average:72.921; most accessible tissue: Minghui63 root, score: 91.517 N N N N
vg0111793207 T -> C LOC_Os01g21130.1 downstream_gene_variant ; 40.0bp to feature; MODIFIER silent_mutation Average:72.921; most accessible tissue: Minghui63 root, score: 91.517 N N N N
vg0111793207 T -> C LOC_Os01g21135.1 downstream_gene_variant ; 387.0bp to feature; MODIFIER silent_mutation Average:72.921; most accessible tissue: Minghui63 root, score: 91.517 N N N N
vg0111793207 T -> C LOC_Os01g21130-LOC_Os01g21135 intergenic_region ; MODIFIER silent_mutation Average:72.921; most accessible tissue: Minghui63 root, score: 91.517 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0111793207 T C 0.01 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0111793207 NA 8.42E-66 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111793207 NA 9.81E-89 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111793207 NA 2.88E-47 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111793207 NA 8.17E-23 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111793207 NA 1.73E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111793207 NA 4.42E-43 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111793207 NA 4.23E-58 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111793207 NA 6.10E-73 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111793207 1.65E-06 6.88E-90 mr1672 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111793207 NA 7.04E-33 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111793207 NA 1.66E-92 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111793207 NA 2.49E-40 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111793207 NA 6.91E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111793207 NA 1.08E-63 mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111793207 NA 6.54E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251