\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111726982:

Variant ID: vg0111726982 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 11726982
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


CGGGCTTTTGTGTTGGCCCGATTGAGATGTGTGTCATCCGTGTGACAGCCGGATGCCCGATTGAGATATTTTACCATATCAGTGACCTTTGCTTAGTGAC[G/A]
GGGGCTATATTCGAAAGAGATGAGGCTTTTAGCCCGTTATAGATGACTGATCCTGTTCCAGTGAATCCACTCTAGCAGAAAAACCTATTTATCGTCAACC

Reverse complement sequence

GGTTGACGATAAATAGGTTTTTCTGCTAGAGTGGATTCACTGGAACAGGATCAGTCATCTATAACGGGCTAAAAGCCTCATCTCTTTCGAATATAGCCCC[C/T]
GTCACTAAGCAAAGGTCACTGATATGGTAAAATATCTCAATCGGGCATCCGGCTGTCACACGGATGACACACATCTCAATCGGGCCAACACAAAAGCCCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 8.90% 0.23% 0.00% NA
All Indica  2759 84.70% 15.00% 0.36% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 86.70% 12.90% 0.34% 0.00% NA
Indica II  465 79.40% 19.60% 1.08% 0.00% NA
Indica III  913 88.70% 11.30% 0.00% 0.00% NA
Indica Intermediate  786 81.60% 18.10% 0.38% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0111726982 G -> A LOC_Os01g21000.1 upstream_gene_variant ; 1534.0bp to feature; MODIFIER silent_mutation Average:43.428; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N
vg0111726982 G -> A LOC_Os01g21010.1 upstream_gene_variant ; 443.0bp to feature; MODIFIER silent_mutation Average:43.428; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N
vg0111726982 G -> A LOC_Os01g20990.1 downstream_gene_variant ; 3249.0bp to feature; MODIFIER silent_mutation Average:43.428; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N
vg0111726982 G -> A LOC_Os01g21000-LOC_Os01g21010 intergenic_region ; MODIFIER silent_mutation Average:43.428; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0111726982 NA 3.32E-06 mr1040_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982 NA 6.23E-07 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982 NA 4.25E-06 mr1105_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982 NA 8.26E-07 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982 NA 2.62E-06 mr1207_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982 NA 7.94E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982 NA 1.86E-09 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982 NA 8.28E-09 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982 NA 5.23E-07 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982 NA 4.53E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982 NA 6.00E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982 NA 6.71E-06 mr1784_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982 NA 4.08E-06 mr1820_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982 NA 1.29E-06 mr1820_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982 NA 3.06E-09 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982 2.66E-07 2.66E-07 mr1885_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982 NA 1.46E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251