Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111726982:

Variant ID: vg0111726982 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 11726982
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

CGGGCTTTTGTGTTGGCCCGATTGAGATGTGTGTCATCCGTGTGACAGCCGGATGCCCGATTGAGATATTTTACCATATCAGTGACCTTTGCTTAGTGAC[G/A]
GGGGCTATATTCGAAAGAGATGAGGCTTTTAGCCCGTTATAGATGACTGATCCTGTTCCAGTGAATCCACTCTAGCAGAAAAACCTATTTATCGTCAACC

Reverse complement sequence

GGTTGACGATAAATAGGTTTTTCTGCTAGAGTGGATTCACTGGAACAGGATCAGTCATCTATAACGGGCTAAAAGCCTCATCTCTTTCGAATATAGCCCC[C/T]
GTCACTAAGCAAAGGTCACTGATATGGTAAAATATCTCAATCGGGCATCCGGCTGTCACACGGATGACACACATCTCAATCGGGCCAACACAAAAGCCCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.90%	8.90%	0.23%	0.00%	NA
All Indica	2759	84.70%	15.00%	0.36%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	86.70%	12.90%	0.34%	0.00%	NA
Indica II	465	79.40%	19.60%	1.08%	0.00%	NA
Indica III	913	88.70%	11.30%	0.00%	0.00%	NA
Indica Intermediate	786	81.60%	18.10%	0.38%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	7.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0111726982	G -> A	LOC_Os01g21000.1	upstream_gene_variant ; 1534.0bp to feature; MODIFIER	silent_mutation	Average:43.428; most accessible tissue: Zhenshan97 young leaf, score: 72.34	N	N	N	N
vg0111726982	G -> A	LOC_Os01g21010.1	upstream_gene_variant ; 443.0bp to feature; MODIFIER	silent_mutation	Average:43.428; most accessible tissue: Zhenshan97 young leaf, score: 72.34	N	N	N	N
vg0111726982	G -> A	LOC_Os01g20990.1	downstream_gene_variant ; 3249.0bp to feature; MODIFIER	silent_mutation	Average:43.428; most accessible tissue: Zhenshan97 young leaf, score: 72.34	N	N	N	N
vg0111726982	G -> A	LOC_Os01g21000-LOC_Os01g21010	intergenic_region ; MODIFIER	silent_mutation	Average:43.428; most accessible tissue: Zhenshan97 young leaf, score: 72.34	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0111726982	NA	3.32E-06	mr1040_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982	NA	6.23E-07	mr1045_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982	NA	4.25E-06	mr1105_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982	NA	8.26E-07	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982	NA	2.62E-06	mr1207_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982	NA	7.94E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982	NA	1.86E-09	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982	NA	8.28E-09	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982	NA	5.23E-07	mr1480_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982	NA	4.53E-06	mr1696_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982	NA	6.00E-06	mr1735_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982	NA	6.71E-06	mr1784_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982	NA	4.08E-06	mr1820_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982	NA	1.29E-06	mr1820_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982	NA	3.06E-09	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982	2.66E-07	2.66E-07	mr1885_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111726982	NA	1.46E-06	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251