\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111724370:

Variant ID: vg0111724370 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 11724370
Reference Allele: CCATAlternative Allele: TCAT,C
Primary Allele: CCATSecondary Allele: TCAT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACTCCTTACAGTTTTTACACAAATATTTTGCTACATTACAACTTTTTCCTAAGATATTTGTCACAAGGTACGAATACTACCAAGAAGGCCAACGCCAGT[CCAT/TCAT,C]
AGACTGGAAGATCTTCTCGGCCAACGGCGACATCGACCTCGCCAGATGGTCTATCTCCGCCGAAGTTCTCCGAGAACGAGCAAAACCCTCACGGAGAAAT

Reverse complement sequence

ATTTCTCCGTGAGGGTTTTGCTCGTTCTCGGAGAACTTCGGCGGAGATAGACCATCTGGCGAGGTCGATGTCGCCGTTGGCCGAGAAGATCTTCCAGTCT[ATGG/ATGA,G]
ACTGGCGTTGGCCTTCTTGGTAGTATTCGTACCTTGTGACAAATATCTTAGGAAAAAGTTGTAATGTAGCAAAATATTTGTGTAAAAACTGTAAGGAGTA

Allele Frequencies:

Populations Population SizeFrequency of CCAT(primary allele) Frequency of TCAT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 0.40% 3.83% 2.41% NA
All Indica  2759 88.70% 0.70% 6.49% 4.13% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 88.70% 0.70% 5.38% 5.21% NA
Indica II  465 95.70% 0.20% 1.72% 2.37% NA
Indica III  913 87.20% 0.80% 8.21% 3.83% NA
Indica Intermediate  786 86.40% 0.80% 8.14% 4.71% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 1.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0111724370 CCAT -> TCAT LOC_Os01g21000.1 missense_variant ; p.Asp263Asn; MODERATE nonsynonymous_codon ; D263N Average:37.652; most accessible tissue: Minghui63 flag leaf, score: 58.568 possibly damaging +1.641 N N
vg0111724370 CCAT -> C LOC_Os01g21000.1 inframe_deletion ; p.Met262del; MODERATE N Average:37.652; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0111724370 CCAT -> C LOC_Os01g21010.1 upstream_gene_variant ; 3054.0bp to feature; MODIFIER N Average:37.652; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0111724370 CCAT -> C LOC_Os01g20990.1 downstream_gene_variant ; 638.0bp to feature; MODIFIER N Average:37.652; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0111724370 CCAT -> DEL LOC_Os01g21000.1 N frameshift_variant Average:37.652; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0111724370 NA 1.83E-06 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111724370 NA 5.51E-07 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111724370 NA 1.34E-07 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111724370 NA 7.64E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111724370 NA 1.93E-06 mr1220_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111724370 NA 9.58E-07 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111724370 NA 7.25E-06 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111724370 NA 3.05E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111724370 NA 4.71E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111724370 NA 1.87E-07 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111724370 NA 7.16E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111724370 NA 7.51E-06 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111724370 NA 2.58E-06 mr1820_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111724370 NA 2.32E-06 mr1820_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111724370 NA 5.59E-07 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251