\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111722806:

Variant ID: vg0111722806 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 11722806
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATAGAGTTCTCGGAAGAAGACCACCCCAAGACCGCCGTTATCCCAGGACGATATCCGATCGTGGTCGAACCCACTATTCGGAACATCAAGGTAGCGC[G/A]
AGTTCTCATCGACAGTGGCAGCTCAATCAATCTTCTTTTCGCCAGCACTTTGGACGCGATGGGAATTCCGCAAAGCGAGTTGACACCAACTGATCAACCC

Reverse complement sequence

GGGTTGATCAGTTGGTGTCAACTCGCTTTGCGGAATTCCCATCGCGTCCAAAGTGCTGGCGAAAAGAAGATTGATTGAGCTGCCACTGTCGATGAGAACT[C/T]
GCGCTACCTTGATGTTCCGAATAGTGGGTTCGACCACGATCGGATATCGTCCTGGGATAACGGCGGTCTTGGGGTGGTCTTCTTCCGAGAACTCTATTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.20% 6.80% 0.00% 0.00% NA
All Indica  2759 88.50% 11.50% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 88.90% 11.10% 0.00% 0.00% NA
Indica II  465 95.50% 4.50% 0.00% 0.00% NA
Indica III  913 87.10% 12.90% 0.00% 0.00% NA
Indica Intermediate  786 85.60% 14.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0111722806 G -> A LOC_Os01g21010.1 upstream_gene_variant ; 4619.0bp to feature; MODIFIER silent_mutation Average:52.302; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N
vg0111722806 G -> A LOC_Os01g21000.1 downstream_gene_variant ; 1541.0bp to feature; MODIFIER silent_mutation Average:52.302; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N
vg0111722806 G -> A LOC_Os01g20990.1 intron_variant ; MODIFIER silent_mutation Average:52.302; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0111722806 NA 2.56E-08 mr1045_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111722806 NA 5.07E-06 mr1207_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111722806 NA 4.23E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111722806 NA 8.06E-06 mr1447_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111722806 NA 2.38E-07 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111722806 9.95E-06 3.01E-06 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111722806 NA 2.71E-07 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111722806 NA 5.35E-06 mr1820_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111722806 NA 3.64E-06 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111722806 NA 4.97E-07 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251