\
| Variant ID: vg0111722806 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 11722806 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 232. )
AAAATAGAGTTCTCGGAAGAAGACCACCCCAAGACCGCCGTTATCCCAGGACGATATCCGATCGTGGTCGAACCCACTATTCGGAACATCAAGGTAGCGC[G/A]
AGTTCTCATCGACAGTGGCAGCTCAATCAATCTTCTTTTCGCCAGCACTTTGGACGCGATGGGAATTCCGCAAAGCGAGTTGACACCAACTGATCAACCC
GGGTTGATCAGTTGGTGTCAACTCGCTTTGCGGAATTCCCATCGCGTCCAAAGTGCTGGCGAAAAGAAGATTGATTGAGCTGCCACTGTCGATGAGAACT[C/T]
GCGCTACCTTGATGTTCCGAATAGTGGGTTCGACCACGATCGGATATCGTCCTGGGATAACGGCGGTCTTGGGGTGGTCTTCTTCCGAGAACTCTATTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.20% | 6.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0111722806 | G -> A | LOC_Os01g21010.1 | upstream_gene_variant ; 4619.0bp to feature; MODIFIER | silent_mutation | Average:52.302; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 | N | N | N | N |
| vg0111722806 | G -> A | LOC_Os01g21000.1 | downstream_gene_variant ; 1541.0bp to feature; MODIFIER | silent_mutation | Average:52.302; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 | N | N | N | N |
| vg0111722806 | G -> A | LOC_Os01g20990.1 | intron_variant ; MODIFIER | silent_mutation | Average:52.302; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0111722806 | NA | 2.56E-08 | mr1045_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111722806 | NA | 5.07E-06 | mr1207_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111722806 | NA | 4.23E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111722806 | NA | 8.06E-06 | mr1447_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111722806 | NA | 2.38E-07 | mr1480_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111722806 | 9.95E-06 | 3.01E-06 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111722806 | NA | 2.71E-07 | mr1735_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111722806 | NA | 5.35E-06 | mr1820_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111722806 | NA | 3.64E-06 | mr1887_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111722806 | NA | 4.97E-07 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |