\
| Variant ID: vg0111652887 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 11652887 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 236. )
CCTATACTTCTAGTATACATAATATACATACATCCTAGCTATAAGATTAACTAGCTAATACCCTTATTCCGATGCCCTCCTGGTACTTCGAGAAGCCACC[C/T]
CCTACTGCCGAGTTTCTTACGACAGCCCATCATGACCATACAACCGGGGCTAAATACGAAGGAATACCCTCCCCAGGGAATTAACTAAGGACTATATACA
TGTATATAGTCCTTAGTTAATTCCCTGGGGAGGGTATTCCTTCGTATTTAGCCCCGGTTGTATGGTCATGATGGGCTGTCGTAAGAAACTCGGCAGTAGG[G/A]
GGTGGCTTCTCGAAGTACCAGGAGGGCATCGGAATAAGGGTATTAGCTAGTTAATCTTATAGCTAGGATGTATGTATATTATGTATACTAGAAGTATAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.80% | 6.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 89.50% | 10.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.40% | 10.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.20% | 12.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0111652887 | C -> T | LOC_Os01g20880.1 | upstream_gene_variant ; 2251.0bp to feature; MODIFIER | silent_mutation | Average:53.251; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0111652887 | C -> T | LOC_Os01g20870.1 | downstream_gene_variant ; 4913.0bp to feature; MODIFIER | silent_mutation | Average:53.251; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0111652887 | C -> T | LOC_Os01g20870-LOC_Os01g20880 | intergenic_region ; MODIFIER | silent_mutation | Average:53.251; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0111652887 | 4.91E-06 | NA | mr1790 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111652887 | NA | 8.06E-07 | mr1045_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111652887 | NA | 5.73E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111652887 | NA | 3.51E-06 | mr1480_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111652887 | NA | 8.49E-06 | mr1820_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111652887 | NA | 2.76E-08 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |