\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111490485:

Variant ID: vg0111490485 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 11490485
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTAACCGGGACTAAAAATTATCTTTAGCCCCGGTTTTTATTGCATCCGGGACTATTGTGGAATTCGGCCGACCGACGAAAGATGGTTTCTCCACCAG[T/C]
GTATGTATATAGTTGATGTTCACCTACTCCTAAAACTCAACATGCAAGTGTGACACATCATCATCCACTAACAATTATCATCTAGAGTATTTTAAAATCA

Reverse complement sequence

TGATTTTAAAATACTCTAGATGATAATTGTTAGTGGATGATGATGTGTCACACTTGCATGTTGAGTTTTAGGAGTAGGTGAACATCAACTATATACATAC[A/G]
CTGGTGGAGAAACCATCTTTCGTCGGTCGGCCGAATTCCACAATAGTCCCGGATGCAATAAAAACCGGGGCTAAAGATAATTTTTAGTCCCGGTTAAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.50% 5.70% 8.29% 44.52% NA
All Indica  2759 22.40% 0.40% 8.52% 68.61% NA
All Japonica  1512 79.20% 16.70% 1.52% 2.65% NA
Aus  269 33.80% 0.00% 21.93% 44.24% NA
Indica I  595 4.20% 0.00% 10.08% 85.71% NA
Indica II  465 22.80% 0.60% 9.25% 67.31% NA
Indica III  913 34.60% 0.10% 7.56% 57.72% NA
Indica Intermediate  786 21.90% 1.00% 8.02% 69.08% NA
Temperate Japonica  767 96.90% 1.20% 0.65% 1.30% NA
Tropical Japonica  504 49.60% 42.90% 2.78% 4.76% NA
Japonica Intermediate  241 84.60% 11.20% 1.66% 2.49% NA
VI/Aromatic  96 18.80% 0.00% 63.54% 17.71% NA
Intermediate  90 37.80% 7.80% 15.56% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0111490485 T -> DEL N N silent_mutation Average:24.29; most accessible tissue: Minghui63 root, score: 40.262 N N N N
vg0111490485 T -> C LOC_Os01g20200.1 upstream_gene_variant ; 892.0bp to feature; MODIFIER silent_mutation Average:24.29; most accessible tissue: Minghui63 root, score: 40.262 N N N N
vg0111490485 T -> C LOC_Os01g20200-LOC_Os01g20204 intergenic_region ; MODIFIER silent_mutation Average:24.29; most accessible tissue: Minghui63 root, score: 40.262 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0111490485 NA 2.92E-07 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 NA 5.64E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 NA 8.77E-08 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 NA 2.81E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 1.11E-11 2.03E-26 mr1301 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 9.47E-08 1.22E-19 mr1301 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 1.76E-10 8.77E-23 mr1410 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 3.64E-06 2.64E-18 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 NA 4.64E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 NA 4.05E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 NA 1.06E-08 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 NA 1.98E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 8.79E-07 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 9.51E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 1.46E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 NA 6.19E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 1.05E-07 2.72E-24 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 NA 5.97E-19 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 3.75E-08 4.08E-21 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 NA 7.10E-16 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 NA 7.51E-14 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111490485 NA 9.37E-13 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251