Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111431821:

Variant ID: vg0111431821 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 11431821
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


GTCAGATCCGCCGCCTCCTCTTCCTCCGCCACTGCCTCGCATGGGGTGTGGGGGCATTGTACGAGGCCCATCCTCACTCAACACGCCGTTCGACCCGTGA[C/T]
TCGTTCCGCGCTAACAAAGGCCTACCAAATCCTAATATAACAAAGAACACATGCCTCAATTTGGCTCCGTAGACTGCGGTCTTCAGGTTGGTAACTCTAG

Reverse complement sequence

CTAGAGTTACCAACCTGAAGACCGCAGTCTACGGAGCCAAATTGAGGCATGTGTTCTTTGTTATATTAGGATTTGGTAGGCCTTTGTTAGCGCGGAACGA[G/A]
TCACGGGTCGAACGGCGTGTTGAGTGAGGATGGGCCTCGTACAATGCCCCCACACCCCATGCGAGGCAGTGGCGGAGGAAGAGGAGGCGGCGGATCTGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.50% 10.20% 0.36% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 68.80% 30.00% 1.12% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 1.00% 0.00% 0.00% NA
Temperate Japonica  767 94.50% 5.10% 0.39% 0.00% NA
Tropical Japonica  504 42.10% 56.90% 0.99% 0.00% NA
Japonica Intermediate  241 43.20% 53.10% 3.73% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0111431821 C -> T LOC_Os01g20120.1 upstream_gene_variant ; 825.0bp to feature; MODIFIER silent_mutation Average:79.772; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N
vg0111431821 C -> T LOC_Os01g20120.2 upstream_gene_variant ; 854.0bp to feature; MODIFIER silent_mutation Average:79.772; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N
vg0111431821 C -> T LOC_Os01g20120.3 upstream_gene_variant ; 825.0bp to feature; MODIFIER silent_mutation Average:79.772; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N
vg0111431821 C -> T LOC_Os01g20120-LOC_Os01g20130 intergenic_region ; MODIFIER silent_mutation Average:79.772; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0111431821 C T 0.0 0.0 0.0 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0111431821 NA 6.96E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111431821 NA 2.51E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111431821 NA 4.62E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111431821 NA 3.90E-13 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111431821 NA 4.64E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111431821 NA 2.09E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111431821 NA 5.81E-06 mr1319_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111431821 NA 8.96E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111431821 NA 7.42E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111431821 NA 2.72E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111431821 NA 6.95E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111431821 NA 3.98E-09 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111431821 NA 2.27E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111431821 NA 7.02E-09 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111431821 2.42E-06 2.68E-13 mr1761_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111431821 NA 7.95E-06 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111431821 NA 1.76E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251