\
| Variant ID: vg0111239136 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 11239136 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTAATAGTAGTATAACAACAGTAGTAGTAATAGTAGTGTAGTAGTAGTACTGGTCGCGCGCCTGGGGAGCCGCGCGACTAGTCGCGTATTAGGGCTCCTC[A/G]
TGCAAATGAGGTTCCTCGGCGGTATTATCTCTAAATTTGGCTGACGTGGTGCCTATGTAGCTCTTTTAACTAGGTCTTCATCCCATGTGTCATTGACGTG
CACGTCAATGACACATGGGATGAAGACCTAGTTAAAAGAGCTACATAGGCACCACGTCAGCCAAATTTAGAGATAATACCGCCGAGGAACCTCATTTGCA[T/C]
GAGGAGCCCTAATACGCGACTAGTCGCGCGGCTCCCCAGGCGCGCGACCAGTACTACTACTACACTACTATTACTACTACTGTTGTTATACTACTATTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.40% | 14.60% | 1.97% | 51.02% | NA |
| All Indica | 2759 | 20.90% | 0.50% | 2.72% | 75.86% | NA |
| All Japonica | 1512 | 52.80% | 44.00% | 0.60% | 2.65% | NA |
| Aus | 269 | 30.50% | 0.00% | 2.97% | 66.54% | NA |
| Indica I | 595 | 21.80% | 1.00% | 1.51% | 75.63% | NA |
| Indica II | 465 | 31.00% | 1.10% | 0.22% | 67.74% | NA |
| Indica III | 913 | 15.30% | 0.00% | 3.50% | 81.16% | NA |
| Indica Intermediate | 786 | 20.70% | 0.40% | 4.20% | 74.68% | NA |
| Temperate Japonica | 767 | 19.20% | 78.90% | 1.04% | 0.91% | NA |
| Tropical Japonica | 504 | 93.70% | 1.20% | 0.00% | 5.16% | NA |
| Japonica Intermediate | 241 | 74.30% | 22.40% | 0.41% | 2.90% | NA |
| VI/Aromatic | 96 | 31.20% | 4.20% | 0.00% | 64.58% | NA |
| Intermediate | 90 | 48.90% | 8.90% | 1.11% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0111239136 | A -> G | LOC_Os01g19800.1 | upstream_gene_variant ; 4325.0bp to feature; MODIFIER | silent_mutation | Average:62.472; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0111239136 | A -> G | LOC_Os01g19800-LOC_Os01g19820 | intergenic_region ; MODIFIER | silent_mutation | Average:62.472; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0111239136 | A -> DEL | N | N | silent_mutation | Average:62.472; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0111239136 | NA | 6.09E-07 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111239136 | NA | 1.70E-06 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111239136 | 3.96E-06 | 3.96E-06 | mr1036_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0111239136 | NA | 6.08E-07 | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |