\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111239136:

Variant ID: vg0111239136 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 11239136
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAATAGTAGTATAACAACAGTAGTAGTAATAGTAGTGTAGTAGTAGTACTGGTCGCGCGCCTGGGGAGCCGCGCGACTAGTCGCGTATTAGGGCTCCTC[A/G]
TGCAAATGAGGTTCCTCGGCGGTATTATCTCTAAATTTGGCTGACGTGGTGCCTATGTAGCTCTTTTAACTAGGTCTTCATCCCATGTGTCATTGACGTG

Reverse complement sequence

CACGTCAATGACACATGGGATGAAGACCTAGTTAAAAGAGCTACATAGGCACCACGTCAGCCAAATTTAGAGATAATACCGCCGAGGAACCTCATTTGCA[T/C]
GAGGAGCCCTAATACGCGACTAGTCGCGCGGCTCCCCAGGCGCGCGACCAGTACTACTACTACACTACTATTACTACTACTGTTGTTATACTACTATTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.40% 14.60% 1.97% 51.02% NA
All Indica  2759 20.90% 0.50% 2.72% 75.86% NA
All Japonica  1512 52.80% 44.00% 0.60% 2.65% NA
Aus  269 30.50% 0.00% 2.97% 66.54% NA
Indica I  595 21.80% 1.00% 1.51% 75.63% NA
Indica II  465 31.00% 1.10% 0.22% 67.74% NA
Indica III  913 15.30% 0.00% 3.50% 81.16% NA
Indica Intermediate  786 20.70% 0.40% 4.20% 74.68% NA
Temperate Japonica  767 19.20% 78.90% 1.04% 0.91% NA
Tropical Japonica  504 93.70% 1.20% 0.00% 5.16% NA
Japonica Intermediate  241 74.30% 22.40% 0.41% 2.90% NA
VI/Aromatic  96 31.20% 4.20% 0.00% 64.58% NA
Intermediate  90 48.90% 8.90% 1.11% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0111239136 A -> G LOC_Os01g19800.1 upstream_gene_variant ; 4325.0bp to feature; MODIFIER silent_mutation Average:62.472; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0111239136 A -> G LOC_Os01g19800-LOC_Os01g19820 intergenic_region ; MODIFIER silent_mutation Average:62.472; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0111239136 A -> DEL N N silent_mutation Average:62.472; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0111239136 NA 6.09E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111239136 NA 1.70E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111239136 3.96E-06 3.96E-06 mr1036_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111239136 NA 6.08E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251