Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111193660:

Variant ID: vg0111193660 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 11193660
Reference Allele: CT	Alternative Allele: AT,C
Primary Allele: CT	Secondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCCGTGGCTGACATGAAATGACGGCACTGAACGCGCTGCTGAAGCCTAGAGGGGGGGTGAATAGGCTGTCCCCGGGACATCCACAATATGCAACGGATT[CT/AT,C]
TGCGGGCGACACCTAACCGTCTAGGAGATCATCTCCAAGAGTAATAAGCACCGAGATGACAGCCCACGAGATATTCCAAGTGCTCACCCAAGATCCTAGT

Reverse complement sequence

ACTAGGATCTTGGGTGAGCACTTGGAATATCTCGTGGGCTGTCATCTCGGTGCTTATTACTCTTGGAGATGATCTCCTAGACGGTTAGGTGTCGCCCGCA[AG/AT,G]
AATCCGTTGCATATTGTGGATGTCCCGGGGACAGCCTATTCACCCCCCCTCTAGGCTTCAGCAGCGCGTTCAGTGCCGTCATTTCATGTCAGCCACGGAC

Allele Frequencies:

Populations	Population Size	Frequency of CT(primary allele)	Frequency of AT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.60%	15.70%	0.97%	0.72%	C: 0.02%
All Indica	2759	90.90%	8.70%	0.40%	0.04%	NA
All Japonica	1512	65.80%	30.10%	2.05%	2.05%	NA
Aus	269	99.30%	0.40%	0.00%	0.00%	C: 0.37%
Indica I	595	80.50%	18.20%	1.34%	0.00%	NA
Indica II	465	86.00%	13.30%	0.43%	0.22%	NA
Indica III	913	99.20%	0.80%	0.00%	0.00%	NA
Indica Intermediate	786	92.00%	7.90%	0.13%	0.00%	NA
Temperate Japonica	767	95.70%	3.90%	0.39%	0.00%	NA
Tropical Japonica	504	22.20%	68.80%	2.98%	5.95%	NA
Japonica Intermediate	241	61.80%	32.40%	5.39%	0.41%	NA
VI/Aromatic	96	71.90%	27.10%	1.04%	0.00%	NA
Intermediate	90	71.10%	23.30%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0111193660	CT -> DEL	N	N	silent_mutation	Average:64.425; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0111193660	CT -> C	LOC_Os01g19720-LOC_Os01g19730	intergenic_region ; MODIFIER	silent_mutation	Average:64.425; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0111193660	CT -> AT	LOC_Os01g19720-LOC_Os01g19730	intergenic_region ; MODIFIER	silent_mutation	Average:64.425; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0111193660	NA	9.54E-12	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660	NA	1.14E-10	mr1454	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660	NA	1.11E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660	NA	5.21E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660	NA	1.17E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660	NA	8.78E-08	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660	NA	7.67E-08	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660	3.59E-07	NA	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660	1.02E-06	7.71E-16	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660	NA	3.00E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660	6.58E-07	NA	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660	NA	4.34E-13	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660	NA	3.85E-06	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660	NA	2.68E-11	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660	1.29E-07	4.81E-15	mr1993_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251