\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111193660:

Variant ID: vg0111193660 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 11193660
Reference Allele: CTAlternative Allele: AT,C
Primary Allele: CTSecondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCCGTGGCTGACATGAAATGACGGCACTGAACGCGCTGCTGAAGCCTAGAGGGGGGGTGAATAGGCTGTCCCCGGGACATCCACAATATGCAACGGATT[CT/AT,C]
TGCGGGCGACACCTAACCGTCTAGGAGATCATCTCCAAGAGTAATAAGCACCGAGATGACAGCCCACGAGATATTCCAAGTGCTCACCCAAGATCCTAGT

Reverse complement sequence

ACTAGGATCTTGGGTGAGCACTTGGAATATCTCGTGGGCTGTCATCTCGGTGCTTATTACTCTTGGAGATGATCTCCTAGACGGTTAGGTGTCGCCCGCA[AG/AT,G]
AATCCGTTGCATATTGTGGATGTCCCGGGGACAGCCTATTCACCCCCCCTCTAGGCTTCAGCAGCGCGTTCAGTGCCGTCATTTCATGTCAGCCACGGAC

Allele Frequencies:

Populations Population SizeFrequency of CT(primary allele) Frequency of AT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 15.70% 0.97% 0.72% C: 0.02%
All Indica  2759 90.90% 8.70% 0.40% 0.04% NA
All Japonica  1512 65.80% 30.10% 2.05% 2.05% NA
Aus  269 99.30% 0.40% 0.00% 0.00% C: 0.37%
Indica I  595 80.50% 18.20% 1.34% 0.00% NA
Indica II  465 86.00% 13.30% 0.43% 0.22% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 92.00% 7.90% 0.13% 0.00% NA
Temperate Japonica  767 95.70% 3.90% 0.39% 0.00% NA
Tropical Japonica  504 22.20% 68.80% 2.98% 5.95% NA
Japonica Intermediate  241 61.80% 32.40% 5.39% 0.41% NA
VI/Aromatic  96 71.90% 27.10% 1.04% 0.00% NA
Intermediate  90 71.10% 23.30% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0111193660 CT -> DEL N N silent_mutation Average:64.425; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0111193660 CT -> C LOC_Os01g19720-LOC_Os01g19730 intergenic_region ; MODIFIER silent_mutation Average:64.425; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0111193660 CT -> AT LOC_Os01g19720-LOC_Os01g19730 intergenic_region ; MODIFIER silent_mutation Average:64.425; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0111193660 NA 9.54E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660 NA 1.14E-10 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660 NA 1.11E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660 NA 5.21E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660 NA 1.17E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660 NA 8.78E-08 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660 NA 7.67E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660 3.59E-07 NA mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660 1.02E-06 7.71E-16 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660 NA 3.00E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660 6.58E-07 NA mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660 NA 4.34E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660 NA 3.85E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660 NA 2.68E-11 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111193660 1.29E-07 4.81E-15 mr1993_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251