Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111138678:

Variant ID: vg0111138678 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 11138678
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

GATTGTCCCGGAAATAGAGTGAGGATCGGCTGGAGTCCGAATCGGCTGCGATCAGGATCGGCAGAGTCCGAGTTGGACAGGGTTAGCCGATTGGACCGAA[T/C]
CCGACAATATGACACGGCATACGTTGTCGAGTTAGGTTGATGTGCTTCATGAGGATTGCCACGCATGGATAGAGTCCTGAGAAGGCAATTGTATTTATTA

Reverse complement sequence

TAATAAATACAATTGCCTTCTCAGGACTCTATCCATGCGTGGCAATCCTCATGAAGCACATCAACCTAACTCGACAACGTATGCCGTGTCATATTGTCGG[A/G]
TTCGGTCCAATCGGCTAACCCTGTCCAACTCGGACTCTGCCGATCCTGATCGCAGCCGATTCGGACTCCAGCCGATCCTCACTCTATTTCCGGGACAATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.70%	2.80%	1.38%	0.19%	NA
All Indica	2759	99.30%	0.40%	0.18%	0.07%	NA
All Japonica	1512	88.20%	7.50%	3.84%	0.40%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.00%	0.50%	0.00%	NA
Indica II	465	98.10%	1.50%	0.22%	0.22%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.60%	0.13%	0.13%	NA
Temperate Japonica	767	98.40%	1.30%	0.26%	0.00%	NA
Tropical Japonica	504	72.20%	16.70%	10.12%	0.99%	NA
Japonica Intermediate	241	89.20%	8.30%	2.07%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	4.40%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0111138678	T -> DEL	N	N	silent_mutation	Average:49.115; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N
vg0111138678	T -> C	LOC_Os01g19640.1	upstream_gene_variant ; 433.0bp to feature; MODIFIER	silent_mutation	Average:49.115; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N
vg0111138678	T -> C	LOC_Os01g19650.1	upstream_gene_variant ; 3444.0bp to feature; MODIFIER	silent_mutation	Average:49.115; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N
vg0111138678	T -> C	LOC_Os01g19640-LOC_Os01g19650	intergenic_region ; MODIFIER	silent_mutation	Average:49.115; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0111138678	NA	7.74E-07	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111138678	NA	2.67E-06	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111138678	NA	9.17E-08	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111138678	NA	1.10E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111138678	2.55E-06	2.54E-06	mr1663	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111138678	NA	1.78E-07	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111138678	NA	3.87E-06	mr1903	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251