\
| Variant ID: vg0110929029 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 10929029 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 105. )
ATCATTACTCAACAATAACGAACTAATCTAACAATATGTTTGCGAGTAATTGATTTACTGACAGAGGCTCCAATGTGAATAAAAACCAATAAATTATTTA[C/T]
GAAAATAATATTGGACGCGAATATAATATGCTAGTAATTCTTTTACTTATGGTTCCACATTGGAAGGAAAACAACATGAATCAATCGGGTGTGCGGGAGT
ACTCCCGCACACCCGATTGATTCATGTTGTTTTCCTTCCAATGTGGAACCATAAGTAAAAGAATTACTAGCATATTATATTCGCGTCCAATATTATTTTC[G/A]
TAAATAATTTATTGGTTTTTATTCACATTGGAGCCTCTGTCAGTAAATCAATTACTCGCAAACATATTGTTAGATTAGTTCGTTATTGTTGAGTAATGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.70% | 9.00% | 4.36% | 7.91% | NA |
| All Indica | 2759 | 68.20% | 14.00% | 6.85% | 10.95% | NA |
| All Japonica | 1512 | 94.50% | 0.30% | 0.93% | 4.30% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 27.70% | 26.90% | 17.31% | 28.07% | NA |
| Indica II | 465 | 85.60% | 6.70% | 2.37% | 5.38% | NA |
| Indica III | 913 | 82.30% | 9.30% | 2.85% | 5.59% | NA |
| Indica Intermediate | 786 | 72.30% | 14.00% | 6.23% | 7.51% | NA |
| Temperate Japonica | 767 | 98.00% | 0.10% | 0.78% | 1.04% | NA |
| Tropical Japonica | 504 | 87.30% | 0.60% | 1.39% | 10.71% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 64.60% | 33.30% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 4.40% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0110929029 | C -> T | LOC_Os01g19310.1 | upstream_gene_variant ; 309.0bp to feature; MODIFIER | silent_mutation | Average:53.026; most accessible tissue: Callus, score: 76.33 | N | N | N | N |
| vg0110929029 | C -> T | LOC_Os01g19320.1 | upstream_gene_variant ; 2595.0bp to feature; MODIFIER | silent_mutation | Average:53.026; most accessible tissue: Callus, score: 76.33 | N | N | N | N |
| vg0110929029 | C -> T | LOC_Os01g19310-LOC_Os01g19320 | intergenic_region ; MODIFIER | silent_mutation | Average:53.026; most accessible tissue: Callus, score: 76.33 | N | N | N | N |
| vg0110929029 | C -> DEL | N | N | silent_mutation | Average:53.026; most accessible tissue: Callus, score: 76.33 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0110929029 | 1.38E-07 | NA | mr1026 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | 7.19E-07 | 8.32E-18 | mr1026 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | 1.08E-06 | 1.23E-16 | mr1118 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | NA | 4.64E-06 | mr1123 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | 5.57E-07 | NA | mr1161 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | 2.90E-06 | 7.04E-17 | mr1161 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | 8.78E-06 | 2.06E-20 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | NA | 5.63E-11 | mr1496 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | NA | 3.28E-11 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | NA | 2.04E-06 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | NA | 6.85E-06 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | NA | 4.28E-16 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | 2.48E-06 | 5.82E-19 | mr1118_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | NA | 1.49E-06 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | NA | 4.54E-06 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | 4.81E-06 | NA | mr1161_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | 4.98E-06 | 1.07E-14 | mr1161_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | NA | 1.78E-24 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | 4.28E-08 | 1.76E-22 | mr1495_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | NA | 1.83E-07 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | NA | 1.39E-11 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110929029 | NA | 1.64E-08 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |