\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0110929029:

Variant ID: vg0110929029 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 10929029
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


ATCATTACTCAACAATAACGAACTAATCTAACAATATGTTTGCGAGTAATTGATTTACTGACAGAGGCTCCAATGTGAATAAAAACCAATAAATTATTTA[C/T]
GAAAATAATATTGGACGCGAATATAATATGCTAGTAATTCTTTTACTTATGGTTCCACATTGGAAGGAAAACAACATGAATCAATCGGGTGTGCGGGAGT

Reverse complement sequence

ACTCCCGCACACCCGATTGATTCATGTTGTTTTCCTTCCAATGTGGAACCATAAGTAAAAGAATTACTAGCATATTATATTCGCGTCCAATATTATTTTC[G/A]
TAAATAATTTATTGGTTTTTATTCACATTGGAGCCTCTGTCAGTAAATCAATTACTCGCAAACATATTGTTAGATTAGTTCGTTATTGTTGAGTAATGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.70% 9.00% 4.36% 7.91% NA
All Indica  2759 68.20% 14.00% 6.85% 10.95% NA
All Japonica  1512 94.50% 0.30% 0.93% 4.30% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 27.70% 26.90% 17.31% 28.07% NA
Indica II  465 85.60% 6.70% 2.37% 5.38% NA
Indica III  913 82.30% 9.30% 2.85% 5.59% NA
Indica Intermediate  786 72.30% 14.00% 6.23% 7.51% NA
Temperate Japonica  767 98.00% 0.10% 0.78% 1.04% NA
Tropical Japonica  504 87.30% 0.60% 1.39% 10.71% NA
Japonica Intermediate  241 98.30% 0.00% 0.41% 1.24% NA
VI/Aromatic  96 64.60% 33.30% 2.08% 0.00% NA
Intermediate  90 86.70% 4.40% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0110929029 C -> T LOC_Os01g19310.1 upstream_gene_variant ; 309.0bp to feature; MODIFIER silent_mutation Average:53.026; most accessible tissue: Callus, score: 76.33 N N N N
vg0110929029 C -> T LOC_Os01g19320.1 upstream_gene_variant ; 2595.0bp to feature; MODIFIER silent_mutation Average:53.026; most accessible tissue: Callus, score: 76.33 N N N N
vg0110929029 C -> T LOC_Os01g19310-LOC_Os01g19320 intergenic_region ; MODIFIER silent_mutation Average:53.026; most accessible tissue: Callus, score: 76.33 N N N N
vg0110929029 C -> DEL N N silent_mutation Average:53.026; most accessible tissue: Callus, score: 76.33 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0110929029 1.38E-07 NA mr1026 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 7.19E-07 8.32E-18 mr1026 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 1.08E-06 1.23E-16 mr1118 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 NA 4.64E-06 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 5.57E-07 NA mr1161 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 2.90E-06 7.04E-17 mr1161 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 8.78E-06 2.06E-20 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 NA 5.63E-11 mr1496 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 NA 3.28E-11 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 NA 2.04E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 NA 6.85E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 NA 4.28E-16 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 2.48E-06 5.82E-19 mr1118_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 NA 1.49E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 NA 4.54E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 4.81E-06 NA mr1161_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 4.98E-06 1.07E-14 mr1161_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 NA 1.78E-24 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 4.28E-08 1.76E-22 mr1495_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 NA 1.83E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 NA 1.39E-11 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110929029 NA 1.64E-08 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251