\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0110928636:

Variant ID: vg0110928636 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 10928636
Reference Allele: TAlternative Allele: C,TGAG
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TGCACAATGTTCAATTGTAGGCTGGGAGTAAGGCGAGCCCAAGAACATTGTAGTCCGGATTTAATTTTTGCTTTCTCATTTTCAGGCACAGCAGAGTACA[T/C,TGAG]
TATGCTCATGGGAATACAGCCGAGTACATTCTCAAATTTGGTTGCTGGCCAGTGCCATGGAGGAGCAGCATCGGCCACCTCCATGACACGCCGCTGTCAA

Reverse complement sequence

TTGACAGCGGCGTGTCATGGAGGTGGCCGATGCTGCTCCTCCATGGCACTGGCCAGCAACCAAATTTGAGAATGTACTCGGCTGTATTCCCATGAGCATA[A/G,CTCA]
TGTACTCTGCTGTGCCTGAAAATGAGAAAGCAAAAATTAAATCCGGACTACAATGTTCTTGGGCTCGCCTTACTCCCAGCCTACAATTGAACATTGTGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.80% 18.70% 5.08% 0.42% NA
All Indica  2759 59.60% 31.60% 8.08% 0.72% NA
All Japonica  1512 99.40% 0.10% 0.53% 0.00% NA
Aus  269 97.40% 0.70% 1.86% 0.00% NA
Indica I  595 76.80% 12.10% 11.09% 0.00% NA
Indica II  465 39.10% 48.60% 12.26% 0.00% NA
Indica III  913 61.60% 34.40% 1.86% 2.19% NA
Indica Intermediate  786 56.40% 33.10% 10.56% 0.00% NA
Temperate Japonica  767 99.00% 0.00% 1.04% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 84.40% 11.10% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0110928636 T -> TGAG LOC_Os01g19310.1 inframe_insertion ; p.Ile28_Met29insLeu; MODERATE N Average:61.739; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg0110928636 T -> TGAG LOC_Os01g19320.1 upstream_gene_variant ; 2987.0bp to feature; MODIFIER N Average:61.739; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg0110928636 T -> DEL LOC_Os01g19310.1 N frameshift_variant Average:61.739; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg0110928636 T -> C LOC_Os01g19310.1 missense_variant ; p.Met29Val; MODERATE nonsynonymous_codon ; M29V Average:61.739; most accessible tissue: Zhenshan97 panicle, score: 85.254 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0110928636 T C 0.02 0.03 0.02 0.06 0.03 0.02
vg0110928636 T TGAG 0.03 0.09 0.05 0.05 0.09 0.13

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0110928636 3.37E-06 3.37E-06 mr1027 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110928636 NA 2.93E-11 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110928636 NA 1.80E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110928636 NA 1.70E-07 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110928636 NA 5.27E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110928636 NA 3.10E-08 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110928636 NA 6.58E-08 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110928636 NA 8.49E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251