\
| Variant ID: vg0110864670 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 10864670 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 76. )
AGCTAGAGGCCCATGTGGTGACCCCTGACCAGATAAAAAGGAGACCCAGGCCTAAGAAAGAAAAAAAAAGAGGAGAAGAGAGGAGGGGAGTTGGGACTCT[G/A]
GCGAATGGTTTCTAGAGCCTGAACTCTCTCTCGCTCTTGGCTCTCTGGATTCCTTCACTCACAGATCCACCAGAACATAGGAGTAGGGTGTTACGCTTCT
AGAAGCGTAACACCCTACTCCTATGTTCTGGTGGATCTGTGAGTGAAGGAATCCAGAGAGCCAAGAGCGAGAGAGAGTTCAGGCTCTAGAAACCATTCGC[C/T]
AGAGTCCCAACTCCCCTCCTCTCTTCTCCTCTTTTTTTTTCTTTCTTAGGCCTGGGTCTCCTTTTTATCTGGTCAGGGGTCACCACATGGGCCTCTAGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 20.20% | 12.20% | 18.22% | 49.34% | NA |
| All Indica | 2759 | 1.30% | 0.80% | 23.45% | 74.45% | NA |
| All Japonica | 1512 | 59.40% | 34.60% | 3.17% | 2.84% | NA |
| Aus | 269 | 0.00% | 0.70% | 46.10% | 53.16% | NA |
| Indica I | 595 | 1.20% | 0.00% | 11.60% | 87.23% | NA |
| Indica II | 465 | 2.40% | 0.60% | 9.89% | 87.10% | NA |
| Indica III | 913 | 0.40% | 0.80% | 42.94% | 55.86% | NA |
| Indica Intermediate | 786 | 1.80% | 1.50% | 17.81% | 78.88% | NA |
| Temperate Japonica | 767 | 94.50% | 2.50% | 1.43% | 1.56% | NA |
| Tropical Japonica | 504 | 14.50% | 75.80% | 4.96% | 4.76% | NA |
| Japonica Intermediate | 241 | 41.50% | 50.60% | 4.98% | 2.90% | NA |
| VI/Aromatic | 96 | 6.20% | 7.30% | 27.08% | 59.38% | NA |
| Intermediate | 90 | 16.70% | 26.70% | 17.78% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0110864670 | G -> A | LOC_Os01g19200.1 | upstream_gene_variant ; 1349.0bp to feature; MODIFIER | silent_mutation | Average:5.325; most accessible tissue: Callus, score: 10.929 | N | N | N | N |
| vg0110864670 | G -> A | LOC_Os01g19210.1 | intron_variant ; MODIFIER | silent_mutation | Average:5.325; most accessible tissue: Callus, score: 10.929 | N | N | N | N |
| vg0110864670 | G -> DEL | N | N | silent_mutation | Average:5.325; most accessible tissue: Callus, score: 10.929 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0110864670 | 4.44E-06 | NA | mr1533 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110864670 | NA | 8.16E-10 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110864670 | NA | 2.14E-08 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110864670 | NA | 4.45E-08 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110864670 | NA | 4.88E-07 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110864670 | 3.53E-06 | NA | mr1698 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110864670 | NA | 4.63E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110864670 | NA | 7.77E-06 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110864670 | NA | 1.73E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110864670 | NA | 6.67E-09 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110864670 | NA | 2.45E-06 | mr1668_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110864670 | NA | 4.88E-08 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110864670 | NA | 1.33E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110864670 | NA | 2.90E-14 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |