Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0110864670:

Variant ID: vg0110864670 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 10864670
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

AGCTAGAGGCCCATGTGGTGACCCCTGACCAGATAAAAAGGAGACCCAGGCCTAAGAAAGAAAAAAAAAGAGGAGAAGAGAGGAGGGGAGTTGGGACTCT[G/A]
GCGAATGGTTTCTAGAGCCTGAACTCTCTCTCGCTCTTGGCTCTCTGGATTCCTTCACTCACAGATCCACCAGAACATAGGAGTAGGGTGTTACGCTTCT

Reverse complement sequence

AGAAGCGTAACACCCTACTCCTATGTTCTGGTGGATCTGTGAGTGAAGGAATCCAGAGAGCCAAGAGCGAGAGAGAGTTCAGGCTCTAGAAACCATTCGC[C/T]
AGAGTCCCAACTCCCCTCCTCTCTTCTCCTCTTTTTTTTTCTTTCTTAGGCCTGGGTCTCCTTTTTATCTGGTCAGGGGTCACCACATGGGCCTCTAGCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	20.20%	12.20%	18.22%	49.34%	NA
All Indica	2759	1.30%	0.80%	23.45%	74.45%	NA
All Japonica	1512	59.40%	34.60%	3.17%	2.84%	NA
Aus	269	0.00%	0.70%	46.10%	53.16%	NA
Indica I	595	1.20%	0.00%	11.60%	87.23%	NA
Indica II	465	2.40%	0.60%	9.89%	87.10%	NA
Indica III	913	0.40%	0.80%	42.94%	55.86%	NA
Indica Intermediate	786	1.80%	1.50%	17.81%	78.88%	NA
Temperate Japonica	767	94.50%	2.50%	1.43%	1.56%	NA
Tropical Japonica	504	14.50%	75.80%	4.96%	4.76%	NA
Japonica Intermediate	241	41.50%	50.60%	4.98%	2.90%	NA
VI/Aromatic	96	6.20%	7.30%	27.08%	59.38%	NA
Intermediate	90	16.70%	26.70%	17.78%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0110864670	G -> A	LOC_Os01g19200.1	upstream_gene_variant ; 1349.0bp to feature; MODIFIER	silent_mutation	Average:5.325; most accessible tissue: Callus, score: 10.929	N	N	N	N
vg0110864670	G -> A	LOC_Os01g19210.1	intron_variant ; MODIFIER	silent_mutation	Average:5.325; most accessible tissue: Callus, score: 10.929	N	N	N	N
vg0110864670	G -> DEL	N	N	silent_mutation	Average:5.325; most accessible tissue: Callus, score: 10.929	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0110864670	4.44E-06	NA	mr1533	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110864670	NA	8.16E-10	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110864670	NA	2.14E-08	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110864670	NA	4.45E-08	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110864670	NA	4.88E-07	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110864670	3.53E-06	NA	mr1698	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110864670	NA	4.63E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110864670	NA	7.77E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110864670	NA	1.73E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110864670	NA	6.67E-09	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110864670	NA	2.45E-06	mr1668_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110864670	NA	4.88E-08	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110864670	NA	1.33E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110864670	NA	2.90E-14	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251