Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0110637699:

Variant ID: vg0110637699 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 10637699
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, A: 0.08, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

TACTCTTCTTCTAATATTTTTTTATTCTTTAATTCCAAATTTCAGTTACTTCTAAATTGTATTTCTATATAGACTCTATACTCTTCTTTCAATATTTTTT[T/A]
AAATTTCGAATTTCAGTTATTTCTAAATTGAATTTCTATATGGACTCTAACCTAATTTTAATTTGGAAAAAAGTACGAATTACCCCCCGAACTATCGCGG

Reverse complement sequence

CCGCGATAGTTCGGGGGGTAATTCGTACTTTTTTCCAAATTAAAATTAGGTTAGAGTCCATATAGAAATTCAATTTAGAAATAACTGAAATTCGAAATTT[A/T]
AAAAAATATTGAAAGAAGAGTATAGAGTCTATATAGAAATACAATTTAGAAGTAACTGAAATTTGGAATTAAAGAATAAAAAAATATTAGAAGAAGAGTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.70%	43.20%	0.04%	0.00%	NA
All Indica	2759	87.40%	12.50%	0.04%	0.00%	NA
All Japonica	1512	3.00%	97.00%	0.00%	0.00%	NA
Aus	269	39.00%	61.00%	0.00%	0.00%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	82.40%	17.60%	0.00%	0.00%	NA
Indica III	913	87.60%	12.40%	0.00%	0.00%	NA
Indica Intermediate	786	82.10%	17.80%	0.13%	0.00%	NA
Temperate Japonica	767	1.60%	98.40%	0.00%	0.00%	NA
Tropical Japonica	504	5.20%	94.80%	0.00%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	43.30%	55.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0110637699	T -> A	LOC_Os01g18830.1	downstream_gene_variant ; 3604.0bp to feature; MODIFIER	silent_mutation	Average:36.589; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0110637699	T -> A	LOC_Os01g18810-LOC_Os01g18830	intergenic_region ; MODIFIER	silent_mutation	Average:36.589; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0110637699	NA	1.19E-33	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	1.00E-26	mr1251	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	1.02E-30	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	3.22E-36	mr1435	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	6.61E-51	mr1089_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	1.47E-07	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	7.38E-07	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	3.32E-06	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	3.43E-37	mr1129_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	2.07E-07	mr1235_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	5.12E-06	mr1247_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	9.89E-38	mr1251_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	2.62E-24	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	3.93E-22	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	5.16E-36	mr1257_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	9.56E-06	mr1403_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	5.65E-38	mr1435_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	1.74E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	3.66E-06	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	9.07E-07	mr1510_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	1.81E-14	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110637699	NA	1.70E-14	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251