| Variant ID: vg0110637699 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 10637699 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, A: 0.08, others allele: 0.00, population size: 116. )
TACTCTTCTTCTAATATTTTTTTATTCTTTAATTCCAAATTTCAGTTACTTCTAAATTGTATTTCTATATAGACTCTATACTCTTCTTTCAATATTTTTT[T/A]
AAATTTCGAATTTCAGTTATTTCTAAATTGAATTTCTATATGGACTCTAACCTAATTTTAATTTGGAAAAAAGTACGAATTACCCCCCGAACTATCGCGG
CCGCGATAGTTCGGGGGGTAATTCGTACTTTTTTCCAAATTAAAATTAGGTTAGAGTCCATATAGAAATTCAATTTAGAAATAACTGAAATTCGAAATTT[A/T]
AAAAAATATTGAAAGAAGAGTATAGAGTCTATATAGAAATACAATTTAGAAGTAACTGAAATTTGGAATTAAAGAATAAAAAAATATTAGAAGAAGAGTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.70% | 43.20% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 87.40% | 12.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 39.00% | 61.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 82.40% | 17.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 82.10% | 17.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 55.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0110637699 | T -> A | LOC_Os01g18830.1 | downstream_gene_variant ; 3604.0bp to feature; MODIFIER | silent_mutation | Average:36.589; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0110637699 | T -> A | LOC_Os01g18810-LOC_Os01g18830 | intergenic_region ; MODIFIER | silent_mutation | Average:36.589; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0110637699 | NA | 1.19E-33 | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110637699 | NA | 1.00E-26 | mr1251 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110637699 | NA | 1.02E-30 | mr1257 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110637699 | NA | 3.22E-36 | mr1435 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110637699 | NA | 6.61E-51 | mr1089_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110637699 | NA | 1.47E-07 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110637699 | NA | 7.38E-07 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110637699 | NA | 3.32E-06 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110637699 | NA | 3.43E-37 | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110637699 | NA | 2.07E-07 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/