\
| Variant ID: vg0110444462 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 10444462 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACCTAACCTGGTCTTGGTCTGGAACCCCTCTCGTTGGCATATGGTGAACCTGTGTCGGCTTCCGAAATGCCTTGTCATGAAAGCCTCAAGGTCTCCAGAC[A/G]
TGGCCGTTCTGCACGGGCTGGGTGATCCGGGTTAGTAATGTCGTGTGGGTAAAGTGCACCCCCTCTGCAGAGGTTATTAAACTGTTCGAACAGCCGTGCC
GGCACGGCTGTTCGAACAGTTTAATAACCTCTGCAGAGGGGGTGCACTTTACCCACACGACATTACTAACCCGGATCACCCAGCCCGTGCAGAACGGCCA[T/C]
GTCTGGAGACCTTGAGGCTTTCATGACAAGGCATTTCGGAAGCCGACACAGGTTCACCATATGCCAACGAGAGGGGTTCCAGACCAAGACCAGGTTAGGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.20% | 32.70% | 0.47% | 5.67% | NA |
| All Indica | 2759 | 93.80% | 1.10% | 0.54% | 4.60% | NA |
| All Japonica | 1512 | 3.30% | 96.60% | 0.00% | 0.07% | NA |
| Aus | 269 | 46.80% | 0.70% | 2.23% | 50.19% | NA |
| Indica I | 595 | 98.00% | 1.20% | 0.34% | 0.50% | NA |
| Indica II | 465 | 98.50% | 0.40% | 0.22% | 0.86% | NA |
| Indica III | 913 | 90.70% | 1.10% | 0.66% | 7.56% | NA |
| Indica Intermediate | 786 | 91.30% | 1.40% | 0.76% | 6.49% | NA |
| Temperate Japonica | 767 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.20% | 94.60% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 13.50% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 52.20% | 42.20% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0110444462 | A -> G | LOC_Os01g18530-LOC_Os01g18550 | intergenic_region ; MODIFIER | silent_mutation | Average:37.759; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | N | N | N | N |
| vg0110444462 | A -> DEL | N | N | silent_mutation | Average:37.759; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0110444462 | NA | 3.58E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110444462 | NA | 9.56E-50 | mr1519 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110444462 | NA | 2.21E-42 | mr1591 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110444462 | NA | 4.40E-23 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110444462 | NA | 5.24E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110444462 | NA | 7.19E-32 | mr1102_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110444462 | NA | 1.70E-39 | mr1152_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110444462 | NA | 8.36E-14 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110444462 | NA | 3.49E-41 | mr1223_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110444462 | NA | 6.51E-45 | mr1519_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110444462 | NA | 4.81E-42 | mr1944_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |