\
| Variant ID: vg0110367769 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 10367769 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTTGATGAATGAAATTGTTGGTTTATAATTTATACTCCCTCCGTTTCGAAATATTTGACGTCATTGACTTTTTTAAACATGTTTGACCGTTTGTCTTATT[C/T]
AAAAAATTTAAGTAATTATTAATTCTTTTCCTATCATTTGATTCATTGTTAAATATATTTTTATGTAGGCATATAATTTTACATATTTCACAAAATTTTT
AAAAATTTTGTGAAATATGTAAAATTATATGCCTACATAAAAATATATTTAACAATGAATCAAATGATAGGAAAAGAATTAATAATTACTTAAATTTTTT[G/A]
AATAAGACAAACGGTCAAACATGTTTAAAAAAGTCAATGACGTCAAATATTTCGAAACGGAGGGAGTATAAATTATAAACCAACAATTTCATTCATCAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.90% | 39.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 93.60% | 6.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 43.10% | 56.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.80% | 9.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.40% | 94.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 48.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0110367769 | C -> T | LOC_Os01g18440.1 | downstream_gene_variant ; 438.0bp to feature; MODIFIER | silent_mutation | Average:39.559; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0110367769 | C -> T | LOC_Os01g18450.1 | downstream_gene_variant ; 2293.0bp to feature; MODIFIER | silent_mutation | Average:39.559; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0110367769 | C -> T | LOC_Os01g18440-LOC_Os01g18450 | intergenic_region ; MODIFIER | silent_mutation | Average:39.559; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0110367769 | NA | 9.34E-49 | mr1125 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110367769 | NA | 1.17E-25 | mr1551 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110367769 | NA | 1.81E-28 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110367769 | NA | 6.50E-62 | mr1125_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110367769 | NA | 1.70E-37 | mr1223_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110367769 | NA | 1.09E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110367769 | NA | 2.97E-24 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110367769 | NA | 2.88E-09 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110367769 | NA | 1.30E-07 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110367769 | NA | 1.41E-08 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110367769 | NA | 6.10E-12 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110367769 | 8.72E-07 | NA | mr1987_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |