\
| Variant ID: vg0110096745 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 10096745 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGTCGAAAGGATCTCCGCCTTAATCTGGAGTGCCCTTGCCGCCGCAGCCGCCTTCGCCACGTCGGCCGCGTTCGGCACTTGCACGGAGGTTGCAGGGGC[T/C]
GAAGGCGGTTGTGATGGCGCTTGTCCTCCTCCATCTTCGGCCGCGGGCGCTGAAGGCTCTGCTCCTTCCTCGGCGGCCATGTCCGGTCCGGCATCGCTTT
AAAGCGATGCCGGACCGGACATGGCCGCCGAGGAAGGAGCAGAGCCTTCAGCGCCCGCGGCCGAAGATGGAGGAGGACAAGCGCCATCACAACCGCCTTC[A/G]
GCCCCTGCAACCTCCGTGCAAGTGCCGAACGCGGCCGACGTGGCGAAGGCGGCTGCGGCGGCAAGGGCACTCCAGATTAAGGCGGAGATCCTTTCGACAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.10% | 32.90% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.80% | 94.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 8.30% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 41.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0110096745 | T -> C | LOC_Os01g18040.1 | synonymous_variant ; p.Ser122Ser; LOW | synonymous_codon | Average:37.298; most accessible tissue: Zhenshan97 flower, score: 49.964 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0110096745 | NA | 1.21E-82 | mr1134 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110096745 | NA | 2.94E-39 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110096745 | NA | 2.77E-73 | mr1629 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110096745 | NA | 4.14E-84 | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110096745 | 6.21E-06 | NA | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110096745 | NA | 3.69E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110096745 | NA | 6.79E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110096745 | NA | 2.80E-22 | mr1175_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110096745 | NA | 1.28E-28 | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110096745 | NA | 1.84E-35 | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110096745 | NA | 3.42E-25 | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110096745 | NA | 1.80E-44 | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110096745 | 3.36E-06 | NA | mr1543_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110096745 | NA | 3.94E-100 | mr1629_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110096745 | NA | 7.00E-07 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110096745 | 1.96E-06 | NA | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110096745 | NA | 1.99E-19 | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110096745 | NA | 1.49E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |