RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0110090809:

Variant ID: vg0110090809 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 10090809
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

GCGGAGGACACAGAGATTTTATACTGGTTCGGGCCTCCATGGTGGATAATAGCCCTATATCCATTTTTTTTTCTTGCCGAAAGGCTTTCATAGTGCCGAA[G/A]
GGCTTCCATGATAGTATGTATATTTTTACAATTTGGCGATTTGGGTGCCACCCATTCTAGACATAGAAGCGCTTGAGAGAGGCGGCGTTCCAGGAATGGT

Reverse complement sequence

ACCATTCCTGGAACGCCGCCTCTCTCAAGCGCTTCTATGTCTAGAATGGGTGGCACCCAAATCGCCAAATTGTAAAAATATACATACTATCATGGAAGCC[C/T]
TTCGGCACTATGAAAGCCTTTCGGCAAGAAAAAAAAATGGATATAGGGCTATTATCCACCATGGAGGCCCGAACCAGTATAAAATCTCTGTGTCCTCCGC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.50%	29.70%	12.10%	14.71%	NA
All Indica	2759	12.30%	46.60%	19.06%	22.00%	NA
All Japonica	1512	96.80%	2.20%	0.66%	0.40%	NA
Aus	269	71.70%	3.70%	1.49%	23.05%	NA
Indica I	595	7.60%	48.60%	23.87%	20.00%	NA
Indica II	465	16.80%	43.70%	18.49%	21.08%	NA
Indica III	913	11.40%	47.60%	16.76%	24.21%	NA
Indica Intermediate	786	14.20%	45.80%	18.45%	21.50%	NA
Temperate Japonica	767	98.30%	1.00%	0.39%	0.26%	NA
Tropical Japonica	504	94.60%	3.80%	1.19%	0.40%	NA
Japonica Intermediate	241	96.30%	2.50%	0.41%	0.83%	NA
VI/Aromatic	96	16.70%	54.20%	16.67%	12.50%	NA
Intermediate	90	51.10%	22.20%	17.78%	8.89%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0110090809	G -> A	LOC_Os01g18030.1	downstream_gene_variant ; 1248.0bp to feature; MODIFIER	silent_mutation	Average:29.198; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0110090809	G -> A	LOC_Os01g18040.1	downstream_gene_variant ; 57.0bp to feature; MODIFIER	silent_mutation	Average:29.198; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0110090809	G -> A	LOC_Os01g18030-LOC_Os01g18040	intergenic_region ; MODIFIER	silent_mutation	Average:29.198; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0110090809	G -> DEL	N	N	silent_mutation	Average:29.198; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0110090809	1.74E-06	NA	mr1069	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110090809	2.90E-06	NA	mr1069	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110090809	7.04E-06	7.04E-06	mr1355	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110090809	2.91E-06	NA	mr1671	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 4 of 4 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0110090809:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact