Variant ID: vg0110090809 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 10090809 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 113. )
GCGGAGGACACAGAGATTTTATACTGGTTCGGGCCTCCATGGTGGATAATAGCCCTATATCCATTTTTTTTTCTTGCCGAAAGGCTTTCATAGTGCCGAA[G/A]
GGCTTCCATGATAGTATGTATATTTTTACAATTTGGCGATTTGGGTGCCACCCATTCTAGACATAGAAGCGCTTGAGAGAGGCGGCGTTCCAGGAATGGT
ACCATTCCTGGAACGCCGCCTCTCTCAAGCGCTTCTATGTCTAGAATGGGTGGCACCCAAATCGCCAAATTGTAAAAATATACATACTATCATGGAAGCC[C/T]
TTCGGCACTATGAAAGCCTTTCGGCAAGAAAAAAAAATGGATATAGGGCTATTATCCACCATGGAGGCCCGAACCAGTATAAAATCTCTGTGTCCTCCGC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 43.50% | 29.70% | 12.10% | 14.71% | NA |
All Indica | 2759 | 12.30% | 46.60% | 19.06% | 22.00% | NA |
All Japonica | 1512 | 96.80% | 2.20% | 0.66% | 0.40% | NA |
Aus | 269 | 71.70% | 3.70% | 1.49% | 23.05% | NA |
Indica I | 595 | 7.60% | 48.60% | 23.87% | 20.00% | NA |
Indica II | 465 | 16.80% | 43.70% | 18.49% | 21.08% | NA |
Indica III | 913 | 11.40% | 47.60% | 16.76% | 24.21% | NA |
Indica Intermediate | 786 | 14.20% | 45.80% | 18.45% | 21.50% | NA |
Temperate Japonica | 767 | 98.30% | 1.00% | 0.39% | 0.26% | NA |
Tropical Japonica | 504 | 94.60% | 3.80% | 1.19% | 0.40% | NA |
Japonica Intermediate | 241 | 96.30% | 2.50% | 0.41% | 0.83% | NA |
VI/Aromatic | 96 | 16.70% | 54.20% | 16.67% | 12.50% | NA |
Intermediate | 90 | 51.10% | 22.20% | 17.78% | 8.89% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0110090809 | G -> A | LOC_Os01g18030.1 | downstream_gene_variant ; 1248.0bp to feature; MODIFIER | silent_mutation | Average:29.198; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
vg0110090809 | G -> A | LOC_Os01g18040.1 | downstream_gene_variant ; 57.0bp to feature; MODIFIER | silent_mutation | Average:29.198; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
vg0110090809 | G -> A | LOC_Os01g18030-LOC_Os01g18040 | intergenic_region ; MODIFIER | silent_mutation | Average:29.198; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
vg0110090809 | G -> DEL | N | N | silent_mutation | Average:29.198; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0110090809 | 1.74E-06 | NA | mr1069 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0110090809 | 2.90E-06 | NA | mr1069 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0110090809 | 7.04E-06 | 7.04E-06 | mr1355 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0110090809 | 2.91E-06 | NA | mr1671 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |