\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0110016398:

Variant ID: vg0110016398 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 10016398
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCACCCTGCTCGCTACTCTCCGCCCTTTACTAGCCTCCGTCTTGCTAGCTGTCCTCCGCTGTGGGACTCCATCTTACTCGCCATCGATGTAGCGCGGA[C/T]
CTTTAGTGGAGAGGATGTGAGGCTAGAGGTAGACTGGTAGAGGATGGGAGGAGGCGGAGGCAAACCAGCAGCCGACGACTACTCTTCTCGATTTAGGTTT

Reverse complement sequence

AAACCTAAATCGAGAAGAGTAGTCGTCGGCTGCTGGTTTGCCTCCGCCTCCTCCCATCCTCTACCAGTCTACCTCTAGCCTCACATCCTCTCCACTAAAG[G/A]
TCCGCGCTACATCGATGGCGAGTAAGATGGAGTCCCACAGCGGAGGACAGCTAGCAAGACGGAGGCTAGTAAAGGGCGGAGAGTAGCGAGCAGGGTGGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.30% 5.40% 0.34% 0.00% NA
All Indica  2759 91.20% 8.30% 0.54% 0.00% NA
All Japonica  1512 98.50% 1.40% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 88.70% 10.10% 1.18% 0.00% NA
Indica II  465 96.60% 3.20% 0.22% 0.00% NA
Indica III  913 93.30% 6.60% 0.11% 0.00% NA
Indica Intermediate  786 87.30% 12.00% 0.76% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0110016398 C -> T LOC_Os01g17410.1 missense_variant ; p.Thr58Ile; MODERATE nonsynonymous_codon ; T58I Average:81.571; most accessible tissue: Zhenshan97 panicle, score: 94.026 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0110016398 C T 0.02 -0.01 -0.01 0.01 0.04 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0110016398 NA 3.69E-07 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110016398 NA 3.96E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110016398 NA 3.11E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110016398 NA 1.65E-06 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110016398 NA 6.31E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110016398 4.69E-06 NA mr1478 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251