\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0109942704:

Variant ID: vg0109942704 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 9942704
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.73, G: 0.28, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


GCCGACGCCGCCCGGCTATCTTCCCGACGGTGTTTATCCCGTCATGGCCTCGGGTCATGACAACTTGGTATCAGAGCCACTCACCATGGCTTCCAATGCC[A/G]
AGTGAGTTCTCCGTATCACGGTGAGCCATCTAGTGTACCCGGTGGATGAGTATCTACTCCACCAGTTGTTTGATGGTTACGGAGCAGAAAAGAATATCAA

Reverse complement sequence

TTGATATTCTTTTCTGCTCCGTAACCATCAAACAACTGGTGGAGTAGATACTCATCCACCGGGTACACTAGATGGCTCACCGTGATACGGAGAACTCACT[T/C]
GGCATTGGAAGCCATGGTGAGTGGCTCTGATACCAAGTTGTCATGACCCGAGGCCATGACGGGATAAACACCGTCGGGAAGATAGCCGGGCGGCGTCGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.70% 33.00% 1.14% 0.11% NA
All Indica  2759 97.70% 2.10% 0.04% 0.14% NA
All Japonica  1512 3.60% 92.90% 3.51% 0.00% NA
Aus  269 79.90% 20.10% 0.00% 0.00% NA
Indica I  595 99.00% 0.80% 0.00% 0.17% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 96.80% 2.80% 0.00% 0.33% NA
Indica Intermediate  786 96.90% 2.90% 0.13% 0.00% NA
Temperate Japonica  767 1.80% 96.00% 2.22% 0.00% NA
Tropical Japonica  504 5.80% 92.90% 1.39% 0.00% NA
Japonica Intermediate  241 4.60% 83.40% 12.03% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 61.10% 37.80% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0109942704 A -> G LOC_Os01g17279.1 intron_variant ; MODIFIER silent_mutation Average:71.837; most accessible tissue: Minghui63 flag leaf, score: 85.5 N N N N
vg0109942704 A -> DEL N N silent_mutation Average:71.837; most accessible tissue: Minghui63 flag leaf, score: 85.5 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0109942704 A G 0.0 0.0 0.0 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0109942704 NA 3.23E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109942704 NA 3.03E-40 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109942704 NA 3.43E-51 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109942704 NA 9.30E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109942704 NA 1.48E-22 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109942704 NA 1.46E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109942704 NA 2.16E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109942704 NA 5.49E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109942704 NA 2.11E-33 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109942704 NA 9.06E-31 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109942704 NA 3.17E-36 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109942704 NA 4.15E-20 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109942704 NA 2.89E-45 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109942704 NA 3.86E-09 mr1576_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109942704 NA 1.94E-20 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251