\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0109768649:

Variant ID: vg0109768649 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 9768649
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAAGAGGCTCAAACCATGGGTGACTGAAATATGTTGCGGACTTCATAAGTTTTCAAGTCTTTTACTTTTATCTTGTCTTAGTGCCTGTTTAGTTCCCAA[A/G]
CAAAATTTTTCACGTTGTCACATCGAATGTTTGGACATATGCATGGAGTATTAAATGTAGACAAAAAAAAATCAATTACACAGTTCGCTAGGAAATTGCC

Reverse complement sequence

GGCAATTTCCTAGCGAACTGTGTAATTGATTTTTTTTTGTCTACATTTAATACTCCATGCATATGTCCAAACATTCGATGTGACAACGTGAAAAATTTTG[T/C]
TTGGGAACTAAACAGGCACTAAGACAAGATAAAAGTAAAAGACTTGAAAACTTATGAAGTCCGCAACATATTTCAGTCACCCATGGTTTGAGCCTCTTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.70% 42.20% 0.08% 0.04% NA
All Indica  2759 90.80% 9.00% 0.11% 0.07% NA
All Japonica  1512 3.30% 96.60% 0.07% 0.00% NA
Aus  269 13.00% 87.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.30% 0.00% 0.17% NA
Indica II  465 85.20% 14.80% 0.00% 0.00% NA
Indica III  913 89.70% 10.10% 0.22% 0.00% NA
Indica Intermediate  786 88.80% 10.90% 0.13% 0.13% NA
Temperate Japonica  767 1.70% 98.20% 0.13% 0.00% NA
Tropical Japonica  504 5.40% 94.60% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 55.60% 44.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0109768649 A -> G LOC_Os01g17040.1 downstream_gene_variant ; 2168.0bp to feature; MODIFIER silent_mutation Average:73.021; most accessible tissue: Zhenshan97 flag leaf, score: 88.993 N N N N
vg0109768649 A -> G LOC_Os01g17050.1 downstream_gene_variant ; 1366.0bp to feature; MODIFIER silent_mutation Average:73.021; most accessible tissue: Zhenshan97 flag leaf, score: 88.993 N N N N
vg0109768649 A -> G LOC_Os01g17040-LOC_Os01g17050 intergenic_region ; MODIFIER silent_mutation Average:73.021; most accessible tissue: Zhenshan97 flag leaf, score: 88.993 N N N N
vg0109768649 A -> DEL N N silent_mutation Average:73.021; most accessible tissue: Zhenshan97 flag leaf, score: 88.993 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0109768649 A G 0.01 0.02 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0109768649 NA 1.55E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109768649 NA 3.23E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109768649 NA 4.38E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109768649 NA 3.81E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109768649 1.13E-06 4.05E-09 mr1310_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109768649 NA 2.81E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109768649 NA 2.07E-45 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109768649 NA 3.93E-26 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251