RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0109515272:

Variant ID: vg0109515272 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 9515272
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCAGTTATTAAAATTTGGCAGCAAATTAAATGTAGTCACTTTTTTTATAACTTTACTAAAATTTGGTAAGGTTGAAAATGGCTTCAAAGTGAATAGGCC[T/C]
ATAGAGACACATAGATCGTTATTAGAGAGAGAGAGAGGGGGGGATTATATACGTAGATAATAAGCGAATGCAACAAGCTGATGTGTGGTGCTATCCTAGA

Reverse complement sequence

TCTAGGATAGCACCACACATCAGCTTGTTGCATTCGCTTATTATCTACGTATATAATCCCCCCCTCTCTCTCTCTCTAATAACGATCTATGTGTCTCTAT[A/G]
GGCCTATTCACTTTGAAGCCATTTTCAACCTTACCAAATTTTAGTAAAGTTATAAAAAAAGTGACTACATTTAATTTGCTGCCAAATTTTAATAACTGGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.80%	17.90%	0.06%	0.28%	NA
All Indica	2759	98.90%	0.50%	0.07%	0.43%	NA
All Japonica	1512	46.20%	53.80%	0.00%	0.00%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	98.50%	0.70%	0.00%	0.84%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.60%	0.20%	0.00%	0.22%	NA
Indica Intermediate	786	98.10%	1.00%	0.25%	0.64%	NA
Temperate Japonica	767	17.10%	82.90%	0.00%	0.00%	NA
Tropical Japonica	504	80.20%	19.80%	0.00%	0.00%	NA
Japonica Intermediate	241	68.00%	32.00%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	84.40%	14.40%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0109515272	T -> DEL	N	N	silent_mutation	Average:61.064; most accessible tissue: Callus, score: 81.251	N	N	N	N
vg0109515272	T -> C	LOC_Os01g16750.1	downstream_gene_variant ; 170.0bp to feature; MODIFIER	silent_mutation	Average:61.064; most accessible tissue: Callus, score: 81.251	N	N	N	N
vg0109515272	T -> C	LOC_Os01g16750-LOC_Os01g16770	intergenic_region ; MODIFIER	silent_mutation	Average:61.064; most accessible tissue: Callus, score: 81.251	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0109515272	NA	1.97E-32	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109515272	NA	3.42E-08	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109515272	2.90E-06	8.51E-40	mr1486	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109515272	NA	9.08E-11	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109515272	NA	3.95E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109515272	NA	4.45E-22	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109515272	NA	9.92E-08	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109515272	NA	3.60E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109515272	NA	2.77E-28	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109515272	NA	1.30E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 14 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0109515272:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact