\
| Variant ID: vg0109515272 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 9515272 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCCAGTTATTAAAATTTGGCAGCAAATTAAATGTAGTCACTTTTTTTATAACTTTACTAAAATTTGGTAAGGTTGAAAATGGCTTCAAAGTGAATAGGCC[T/C]
ATAGAGACACATAGATCGTTATTAGAGAGAGAGAGAGGGGGGGATTATATACGTAGATAATAAGCGAATGCAACAAGCTGATGTGTGGTGCTATCCTAGA
TCTAGGATAGCACCACACATCAGCTTGTTGCATTCGCTTATTATCTACGTATATAATCCCCCCCTCTCTCTCTCTCTAATAACGATCTATGTGTCTCTAT[A/G]
GGCCTATTCACTTTGAAGCCATTTTCAACCTTACCAAATTTTAGTAAAGTTATAAAAAAAGTGACTACATTTAATTTGCTGCCAAATTTTAATAACTGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.80% | 17.90% | 0.06% | 0.28% | NA |
| All Indica | 2759 | 98.90% | 0.50% | 0.07% | 0.43% | NA |
| All Japonica | 1512 | 46.20% | 53.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 98.50% | 0.70% | 0.00% | 0.84% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.20% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 98.10% | 1.00% | 0.25% | 0.64% | NA |
| Temperate Japonica | 767 | 17.10% | 82.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.00% | 32.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 14.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0109515272 | T -> DEL | N | N | silent_mutation | Average:61.064; most accessible tissue: Callus, score: 81.251 | N | N | N | N |
| vg0109515272 | T -> C | LOC_Os01g16750.1 | downstream_gene_variant ; 170.0bp to feature; MODIFIER | silent_mutation | Average:61.064; most accessible tissue: Callus, score: 81.251 | N | N | N | N |
| vg0109515272 | T -> C | LOC_Os01g16750-LOC_Os01g16770 | intergenic_region ; MODIFIER | silent_mutation | Average:61.064; most accessible tissue: Callus, score: 81.251 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0109515272 | NA | 1.97E-32 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109515272 | NA | 3.42E-08 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109515272 | 2.90E-06 | 8.51E-40 | mr1486 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109515272 | NA | 9.08E-11 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109515272 | NA | 3.95E-06 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109515272 | NA | 4.45E-22 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109515272 | NA | 9.92E-08 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109515272 | NA | 3.60E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109515272 | NA | 2.77E-28 | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109515272 | NA | 1.30E-12 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109515272 | NA | 7.41E-08 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109515272 | NA | 7.47E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109515272 | NA | 1.31E-09 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109515272 | NA | 2.88E-11 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |