\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0109422374:

Variant ID: vg0109422374 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 9422374
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, T: 0.01, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TGTAATTTTAATAATTTAATGTACACTATATTTACATAGGACTTTATTATTATTTTTGAGTGATATTTATTTTCTTAACTTCTACTCCATTCTCGAAATC[C/T]
TGCGTCCGCCACTAGTTGCGGAGGCCGCGCTTAAGGATGCGGAACTCGAGCCGCCTGGGCGCGTTGCTAGAGGGCAACACGTACGATGTATCTCCGCGGC

Reverse complement sequence

GCCGCGGAGATACATCGTACGTGTTGCCCTCTAGCAACGCGCCCAGGCGGCTCGAGTTCCGCATCCTTAAGCGCGGCCTCCGCAACTAGTGGCGGACGCA[G/A]
GATTTCGAGAATGGAGTAGAAGTTAAGAAAATAAATATCACTCAAAAATAATAATAAAGTCCTATGTAAATATAGTGTACATTAAATTATTAAAATTACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.70% 5.60% 1.74% 0.00% NA
All Indica  2759 88.70% 8.40% 2.83% 0.00% NA
All Japonica  1512 97.90% 1.90% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 83.70% 9.70% 6.55% 0.00% NA
Indica II  465 91.80% 6.20% 1.94% 0.00% NA
Indica III  913 92.10% 7.40% 0.44% 0.00% NA
Indica Intermediate  786 86.80% 9.90% 3.31% 0.00% NA
Temperate Japonica  767 99.30% 0.50% 0.13% 0.00% NA
Tropical Japonica  504 95.60% 4.20% 0.20% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 1.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0109422374 C -> T LOC_Os01g16590.1 upstream_gene_variant ; 2393.0bp to feature; MODIFIER silent_mutation Average:69.052; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0109422374 C -> T LOC_Os01g16600.1 upstream_gene_variant ; 2182.0bp to feature; MODIFIER silent_mutation Average:69.052; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0109422374 C -> T LOC_Os01g16590-LOC_Os01g16600 intergenic_region ; MODIFIER silent_mutation Average:69.052; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0109422374 8.33E-07 NA mr1011 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109422374 7.00E-06 NA mr1012 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109422374 NA 4.39E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109422374 NA 1.50E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109422374 NA 4.60E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251