Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0109416363:

Variant ID: vg0109416363 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 9416363
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTGAGTTTTCTTTGAAGTTTCTCACATTTAGGTTTTTAATGAGGCAACAGTGCAATATAAGTAGCGTGTACTATGTACTCTTTCTCCTATTCATTTTT[C/T]
TCCCATTGGGTTTTTGGAAGGAGTTTCGATGAGGCATATGTATAGCGCGGTATTCGCCCAAGGGGGAGTGTTATGAAACCGATCTCCCGAAGGAGTCGGA

Reverse complement sequence

TCCGACTCCTTCGGGAGATCGGTTTCATAACACTCCCCCTTGGGCGAATACCGCGCTATACATATGCCTCATCGAAACTCCTTCCAAAAACCCAATGGGA[G/A]
AAAAATGAATAGGAGAAAGAGTACATAGTACACGCTACTTATATTGCACTGTTGCCTCATTAAAAACCTAAATGTGAGAAACTTCAAAGAAAACTCACTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.00%	3.20%	9.50%	52.33%	NA
All Indica	2759	4.40%	0.20%	10.84%	84.56%	NA
All Japonica	1512	86.00%	9.30%	2.25%	2.51%	NA
Aus	269	62.50%	0.00%	21.93%	15.61%	NA
Indica I	595	6.60%	0.00%	8.57%	84.87%	NA
Indica II	465	1.30%	0.40%	19.35%	78.92%	NA
Indica III	913	2.00%	0.00%	8.98%	89.05%	NA
Indica Intermediate	786	7.50%	0.40%	9.67%	82.44%	NA
Temperate Japonica	767	95.60%	1.80%	1.43%	1.17%	NA
Tropical Japonica	504	73.00%	19.40%	3.37%	4.17%	NA
Japonica Intermediate	241	82.60%	11.60%	2.49%	3.32%	NA
VI/Aromatic	96	30.20%	0.00%	45.83%	23.96%	NA
Intermediate	90	37.80%	6.70%	14.44%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0109416363	C -> T	LOC_Os01g16570.1	downstream_gene_variant ; 4010.0bp to feature; MODIFIER	silent_mutation	Average:10.328; most accessible tissue: Callus, score: 26.628	N	N	N	N
vg0109416363	C -> T	LOC_Os01g16580.1	downstream_gene_variant ; 360.0bp to feature; MODIFIER	silent_mutation	Average:10.328; most accessible tissue: Callus, score: 26.628	N	N	N	N
vg0109416363	C -> T	LOC_Os01g16590.1	downstream_gene_variant ; 2966.0bp to feature; MODIFIER	silent_mutation	Average:10.328; most accessible tissue: Callus, score: 26.628	N	N	N	N
vg0109416363	C -> T	LOC_Os01g16580-LOC_Os01g16590	intergenic_region ; MODIFIER	silent_mutation	Average:10.328; most accessible tissue: Callus, score: 26.628	N	N	N	N
vg0109416363	C -> DEL	N	N	silent_mutation	Average:10.328; most accessible tissue: Callus, score: 26.628	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0109416363	6.93E-06	6.93E-06	mr1085	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363	NA	8.91E-06	mr1088	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363	NA	6.00E-07	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363	NA	1.01E-09	mr1213	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363	NA	9.80E-06	mr1246	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363	NA	1.25E-06	mr1404	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363	NA	5.84E-15	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363	NA	3.04E-06	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363	NA	6.91E-07	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363	2.13E-06	3.04E-06	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363	NA	1.26E-06	mr1155_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363	8.09E-06	NA	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363	NA	3.26E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363	NA	7.83E-13	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251