\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0109416363:

Variant ID: vg0109416363 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 9416363
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTGAGTTTTCTTTGAAGTTTCTCACATTTAGGTTTTTAATGAGGCAACAGTGCAATATAAGTAGCGTGTACTATGTACTCTTTCTCCTATTCATTTTT[C/T]
TCCCATTGGGTTTTTGGAAGGAGTTTCGATGAGGCATATGTATAGCGCGGTATTCGCCCAAGGGGGAGTGTTATGAAACCGATCTCCCGAAGGAGTCGGA

Reverse complement sequence

TCCGACTCCTTCGGGAGATCGGTTTCATAACACTCCCCCTTGGGCGAATACCGCGCTATACATATGCCTCATCGAAACTCCTTCCAAAAACCCAATGGGA[G/A]
AAAAATGAATAGGAGAAAGAGTACATAGTACACGCTACTTATATTGCACTGTTGCCTCATTAAAAACCTAAATGTGAGAAACTTCAAAGAAAACTCACTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.00% 3.20% 9.50% 52.33% NA
All Indica  2759 4.40% 0.20% 10.84% 84.56% NA
All Japonica  1512 86.00% 9.30% 2.25% 2.51% NA
Aus  269 62.50% 0.00% 21.93% 15.61% NA
Indica I  595 6.60% 0.00% 8.57% 84.87% NA
Indica II  465 1.30% 0.40% 19.35% 78.92% NA
Indica III  913 2.00% 0.00% 8.98% 89.05% NA
Indica Intermediate  786 7.50% 0.40% 9.67% 82.44% NA
Temperate Japonica  767 95.60% 1.80% 1.43% 1.17% NA
Tropical Japonica  504 73.00% 19.40% 3.37% 4.17% NA
Japonica Intermediate  241 82.60% 11.60% 2.49% 3.32% NA
VI/Aromatic  96 30.20% 0.00% 45.83% 23.96% NA
Intermediate  90 37.80% 6.70% 14.44% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0109416363 C -> T LOC_Os01g16570.1 downstream_gene_variant ; 4010.0bp to feature; MODIFIER silent_mutation Average:10.328; most accessible tissue: Callus, score: 26.628 N N N N
vg0109416363 C -> T LOC_Os01g16580.1 downstream_gene_variant ; 360.0bp to feature; MODIFIER silent_mutation Average:10.328; most accessible tissue: Callus, score: 26.628 N N N N
vg0109416363 C -> T LOC_Os01g16590.1 downstream_gene_variant ; 2966.0bp to feature; MODIFIER silent_mutation Average:10.328; most accessible tissue: Callus, score: 26.628 N N N N
vg0109416363 C -> T LOC_Os01g16580-LOC_Os01g16590 intergenic_region ; MODIFIER silent_mutation Average:10.328; most accessible tissue: Callus, score: 26.628 N N N N
vg0109416363 C -> DEL N N silent_mutation Average:10.328; most accessible tissue: Callus, score: 26.628 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0109416363 6.93E-06 6.93E-06 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363 NA 8.91E-06 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363 NA 6.00E-07 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363 NA 1.01E-09 mr1213 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363 NA 9.80E-06 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363 NA 1.25E-06 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363 NA 5.84E-15 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363 NA 3.04E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363 NA 6.91E-07 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363 2.13E-06 3.04E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363 NA 1.26E-06 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363 8.09E-06 NA mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363 NA 3.26E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109416363 NA 7.83E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251