Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0109404215:

Variant ID: vg0109404215 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 9404215
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACGCCGAAGCAGCTGCGTATCATGAGGCGGCTCACCCCGCCAGTGTTGTTGCGGAGGCCGCGTTTGCGGATGCTTGCGGAACTCGAGCCGCCTGGGCGT[C/G]
TCGCTACTCGCTAGAGGGCGATATGATGCATCTCCCCGGCATCTGCTGTGACTGTTGATTCATCTTCTCTCTTCCTACTGGCTTGGAGACTTCAATTCGG

Reverse complement sequence

CCGAATTGAAGTCTCCAAGCCAGTAGGAAGAGAGAAGATGAATCAACAGTCACAGCAGATGCCGGGGAGATGCATCATATCGCCCTCTAGCGAGTAGCGA[G/C]
ACGCCCAGGCGGCTCGAGTTCCGCAAGCATCCGCAAACGCGGCCTCCGCAACAACACTGGCGGGGTGAGCCGCCTCATGATACGCAGCTGCTTCGGCGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 32.90% 0.00% 0.00% NA
All Indica  2759 97.80% 2.20% 0.00% 0.00% NA
All Japonica  1512 5.00% 95.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 3.30% 0.00% 0.00% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 7.10% 92.90% 0.00% 0.00% NA
Japonica Intermediate  241 9.50% 90.50% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0109404215 C -> G LOC_Os01g16560.1 upstream_gene_variant ; 493.0bp to feature; MODIFIER silent_mutation Average:75.93; most accessible tissue: Zhenshan97 flower, score: 84.119 N N N N
vg0109404215 C -> G LOC_Os01g16560-LOC_Os01g16570 intergenic_region ; MODIFIER silent_mutation Average:75.93; most accessible tissue: Zhenshan97 flower, score: 84.119 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0109404215 C G 0.04 0.03 0.04 0.04 0.06 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0109404215 NA 5.56E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 2.17E-35 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 8.81E-85 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 7.48E-45 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 5.62E-26 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 1.19E-43 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 5.80E-50 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 6.11E-22 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 3.19E-83 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 9.92E-52 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 1.46E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 2.18E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 1.14E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 1.65E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 1.44E-35 mr1102_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 3.75E-30 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 5.92E-101 mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 6.33E-53 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 3.58E-52 mr1194_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 1.91E-38 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 7.64E-53 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 3.39E-50 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 7.53E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 1.32E-11 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 7.31E-18 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 1.73E-80 mr1711_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 8.19E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109404215 NA 3.79E-22 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251