Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0109389615:

Variant ID: vg0109389615 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 9389615
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, G: 0.05, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TATGTGGACCTGGTACCCTTATTGAACTTGGGACATCGACTACCCTCTCAGAGGTCAGTAATACACTCAATACCTTGTAACTATGTTGAGAATTTCTGAT[G/T]
TCATGAACACGTTTCCTTGCTAGACTCACTTTGCTAGCTTAGCCACATAATCACACTAGTATGTGACGTACTTCAGCTGTTAATGGCAGTCTGAACCTCT

Reverse complement sequence

AGAGGTTCAGACTGCCATTAACAGCTGAAGTACGTCACATACTAGTGTGATTATGTGGCTAAGCTAGCAAAGTGAGTCTAGCAAGGAAACGTGTTCATGA[C/A]
ATCAGAAATTCTCAACATAGTTACAAGGTATTGAGTGTATTACTGACCTCTGAGAGGGTAGTCGATGTCCCAAGTTCAATAAGGGTACCAGGTCCACATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.60% 33.10% 0.02% 0.32% NA
All Indica  2759 97.40% 2.20% 0.04% 0.29% NA
All Japonica  1512 5.00% 94.80% 0.00% 0.26% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.10% 3.50% 0.00% 0.34% NA
Indica II  465 98.90% 0.60% 0.22% 0.22% NA
Indica III  913 98.60% 1.10% 0.00% 0.33% NA
Indica Intermediate  786 96.20% 3.60% 0.00% 0.25% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 6.90% 92.70% 0.00% 0.40% NA
Japonica Intermediate  241 10.00% 89.20% 0.00% 0.83% NA
VI/Aromatic  96 68.80% 31.20% 0.00% 0.00% NA
Intermediate  90 56.70% 40.00% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0109389615 G -> T LOC_Os01g16550.1 downstream_gene_variant ; 4746.0bp to feature; MODIFIER silent_mutation Average:71.693; most accessible tissue: Minghui63 flower, score: 82.765 N N N N
vg0109389615 G -> T LOC_Os01g16540.1 intron_variant ; MODIFIER silent_mutation Average:71.693; most accessible tissue: Minghui63 flower, score: 82.765 N N N N
vg0109389615 G -> DEL N N silent_mutation Average:71.693; most accessible tissue: Minghui63 flower, score: 82.765 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0109389615 G T -0.02 0.0 0.0 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0109389615 NA 3.31E-89 mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 5.51E-80 mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 1.21E-35 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 7.77E-87 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 1.22E-90 mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 4.12E-44 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 1.61E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 1.70E-45 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 3.60E-96 mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 1.74E-35 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 2.53E-43 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 6.83E-08 1.79E-55 mr1519 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 1.64E-19 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 2.07E-23 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 4.87E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 9.40E-94 mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 2.91E-85 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 1.88E-51 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 2.00E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 1.89E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 2.87E-53 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 1.79E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 1.03E-33 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 9.86E-99 mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 3.65E-52 mr1194_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 8.83E-37 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 3.71E-50 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 1.16E-46 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 2.34E-08 6.54E-54 mr1519_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 6.61E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109389615 NA 7.87E-21 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251