\
| Variant ID: vg0109359620 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 9359620 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, G: 0.05, others allele: 0.00, population size: 259. )
CTGGATGCGGTGTGCACGAGTGTCTTCTCACTTCGCGACTTCGATCAGTCACTTGAGTTATACACTCTCCCGAGCCCCCAGCCTTGTCGTCGGAGAACTC[T/G]
TCTCGGAAGATAAGGCTCTTGGACCTTCGACTTGCCTTAGTTGAACAAGCACTGATCCTAGCCCCTAGCCATGAAGTTGGAAAAATCCATTTCCGATTAC
GTAATCGGAAATGGATTTTTCCAACTTCATGGCTAGGGGCTAGGATCAGTGCTTGTTCAACTAAGGCAAGTCGAAGGTCCAAGAGCCTTATCTTCCGAGA[A/C]
GAGTTCTCCGACGACAAGGCTGGGGGCTCGGGAGAGTGTATAACTCAAGTGACTGATCGAAGTCGCGAAGTGAGAAGACACTCGTGCACACCGCATCCAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.00% | 39.60% | 0.19% | 0.23% | NA |
| All Indica | 2759 | 95.30% | 4.20% | 0.33% | 0.14% | NA |
| All Japonica | 1512 | 3.20% | 96.50% | 0.00% | 0.26% | NA |
| Aus | 269 | 38.30% | 61.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.30% | 5.20% | 0.34% | 0.17% | NA |
| Indica II | 465 | 95.90% | 3.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 98.10% | 1.50% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 92.50% | 6.90% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.40% | 94.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 2.90% | 96.30% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 45.60% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0109359620 | T -> G | LOC_Os01g16480.1 | downstream_gene_variant ; 220.0bp to feature; MODIFIER | silent_mutation | Average:34.269; most accessible tissue: Zhenshan97 flower, score: 45.068 | N | N | N | N |
| vg0109359620 | T -> G | LOC_Os01g16490.1 | downstream_gene_variant ; 1733.0bp to feature; MODIFIER | silent_mutation | Average:34.269; most accessible tissue: Zhenshan97 flower, score: 45.068 | N | N | N | N |
| vg0109359620 | T -> G | LOC_Os01g16500.1 | downstream_gene_variant ; 4126.0bp to feature; MODIFIER | silent_mutation | Average:34.269; most accessible tissue: Zhenshan97 flower, score: 45.068 | N | N | N | N |
| vg0109359620 | T -> G | LOC_Os01g16480-LOC_Os01g16490 | intergenic_region ; MODIFIER | silent_mutation | Average:34.269; most accessible tissue: Zhenshan97 flower, score: 45.068 | N | N | N | N |
| vg0109359620 | T -> DEL | N | N | silent_mutation | Average:34.269; most accessible tissue: Zhenshan97 flower, score: 45.068 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0109359620 | NA | 4.90E-15 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109359620 | NA | 3.13E-16 | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109359620 | NA | 5.65E-21 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109359620 | NA | 1.79E-18 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109359620 | NA | 2.52E-06 | mr1117_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109359620 | NA | 7.30E-32 | mr1913_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |