\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0109359620:

Variant ID: vg0109359620 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 9359620
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, G: 0.05, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CTGGATGCGGTGTGCACGAGTGTCTTCTCACTTCGCGACTTCGATCAGTCACTTGAGTTATACACTCTCCCGAGCCCCCAGCCTTGTCGTCGGAGAACTC[T/G]
TCTCGGAAGATAAGGCTCTTGGACCTTCGACTTGCCTTAGTTGAACAAGCACTGATCCTAGCCCCTAGCCATGAAGTTGGAAAAATCCATTTCCGATTAC

Reverse complement sequence

GTAATCGGAAATGGATTTTTCCAACTTCATGGCTAGGGGCTAGGATCAGTGCTTGTTCAACTAAGGCAAGTCGAAGGTCCAAGAGCCTTATCTTCCGAGA[A/C]
GAGTTCTCCGACGACAAGGCTGGGGGCTCGGGAGAGTGTATAACTCAAGTGACTGATCGAAGTCGCGAAGTGAGAAGACACTCGTGCACACCGCATCCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 39.60% 0.19% 0.23% NA
All Indica  2759 95.30% 4.20% 0.33% 0.14% NA
All Japonica  1512 3.20% 96.50% 0.00% 0.26% NA
Aus  269 38.30% 61.70% 0.00% 0.00% NA
Indica I  595 94.30% 5.20% 0.34% 0.17% NA
Indica II  465 95.90% 3.70% 0.43% 0.00% NA
Indica III  913 98.10% 1.50% 0.00% 0.33% NA
Indica Intermediate  786 92.50% 6.90% 0.64% 0.00% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 5.40% 94.20% 0.00% 0.40% NA
Japonica Intermediate  241 2.90% 96.30% 0.00% 0.83% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 51.10% 45.60% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0109359620 T -> G LOC_Os01g16480.1 downstream_gene_variant ; 220.0bp to feature; MODIFIER silent_mutation Average:34.269; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N
vg0109359620 T -> G LOC_Os01g16490.1 downstream_gene_variant ; 1733.0bp to feature; MODIFIER silent_mutation Average:34.269; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N
vg0109359620 T -> G LOC_Os01g16500.1 downstream_gene_variant ; 4126.0bp to feature; MODIFIER silent_mutation Average:34.269; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N
vg0109359620 T -> G LOC_Os01g16480-LOC_Os01g16490 intergenic_region ; MODIFIER silent_mutation Average:34.269; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N
vg0109359620 T -> DEL N N silent_mutation Average:34.269; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0109359620 NA 4.90E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109359620 NA 3.13E-16 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109359620 NA 5.65E-21 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109359620 NA 1.79E-18 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109359620 NA 2.52E-06 mr1117_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109359620 NA 7.30E-32 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251