Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0109359620:

Variant ID: vg0109359620 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 9359620
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, G: 0.05, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CTGGATGCGGTGTGCACGAGTGTCTTCTCACTTCGCGACTTCGATCAGTCACTTGAGTTATACACTCTCCCGAGCCCCCAGCCTTGTCGTCGGAGAACTC[T/G]
TCTCGGAAGATAAGGCTCTTGGACCTTCGACTTGCCTTAGTTGAACAAGCACTGATCCTAGCCCCTAGCCATGAAGTTGGAAAAATCCATTTCCGATTAC

Reverse complement sequence

GTAATCGGAAATGGATTTTTCCAACTTCATGGCTAGGGGCTAGGATCAGTGCTTGTTCAACTAAGGCAAGTCGAAGGTCCAAGAGCCTTATCTTCCGAGA[A/C]
GAGTTCTCCGACGACAAGGCTGGGGGCTCGGGAGAGTGTATAACTCAAGTGACTGATCGAAGTCGCGAAGTGAGAAGACACTCGTGCACACCGCATCCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.00%	39.60%	0.19%	0.23%	NA
All Indica	2759	95.30%	4.20%	0.33%	0.14%	NA
All Japonica	1512	3.20%	96.50%	0.00%	0.26%	NA
Aus	269	38.30%	61.70%	0.00%	0.00%	NA
Indica I	595	94.30%	5.20%	0.34%	0.17%	NA
Indica II	465	95.90%	3.70%	0.43%	0.00%	NA
Indica III	913	98.10%	1.50%	0.00%	0.33%	NA
Indica Intermediate	786	92.50%	6.90%	0.64%	0.00%	NA
Temperate Japonica	767	2.00%	98.00%	0.00%	0.00%	NA
Tropical Japonica	504	5.40%	94.20%	0.00%	0.40%	NA
Japonica Intermediate	241	2.90%	96.30%	0.00%	0.83%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	51.10%	45.60%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0109359620	T -> G	LOC_Os01g16480.1	downstream_gene_variant ; 220.0bp to feature; MODIFIER	silent_mutation	Average:34.269; most accessible tissue: Zhenshan97 flower, score: 45.068	N	N	N	N
vg0109359620	T -> G	LOC_Os01g16490.1	downstream_gene_variant ; 1733.0bp to feature; MODIFIER	silent_mutation	Average:34.269; most accessible tissue: Zhenshan97 flower, score: 45.068	N	N	N	N
vg0109359620	T -> G	LOC_Os01g16500.1	downstream_gene_variant ; 4126.0bp to feature; MODIFIER	silent_mutation	Average:34.269; most accessible tissue: Zhenshan97 flower, score: 45.068	N	N	N	N
vg0109359620	T -> G	LOC_Os01g16480-LOC_Os01g16490	intergenic_region ; MODIFIER	silent_mutation	Average:34.269; most accessible tissue: Zhenshan97 flower, score: 45.068	N	N	N	N
vg0109359620	T -> DEL	N	N	silent_mutation	Average:34.269; most accessible tissue: Zhenshan97 flower, score: 45.068	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0109359620	NA	4.90E-15	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109359620	NA	3.13E-16	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109359620	NA	5.65E-21	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109359620	NA	1.79E-18	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109359620	NA	2.52E-06	mr1117_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109359620	NA	7.30E-32	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251