\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0108957658:

Variant ID: vg0108957658 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 8957658
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GCATTTCAAATGGGGCCTTAATCTCTAACTCTTGCTCAATGGATTGGGCCTGGTTGTAGTTTTACAAATTTACAATACAATAATGTAGAAGGGAAAGTCT[A/T]
TTTTTTTCTCCCTTGATTATAAGTCGAGTCTGATTGGCATCCACTAATCGCACAACCAGATATAGAGAGTCCTTAAACTATCAAACCGGCTTGTTTTGAC

Reverse complement sequence

GTCAAAACAAGCCGGTTTGATAGTTTAAGGACTCTCTATATCTGGTTGTGCGATTAGTGGATGCCAATCAGACTCGACTTATAATCAAGGGAGAAAAAAA[T/A]
AGACTTTCCCTTCTACATTATTGTATTGTAAATTTGTAAAACTACAACCAGGCCCAATCCATTGAGCAAGAGTTAGAGATTAAGGCCCCATTTGAAATGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.70% 25.60% 3.22% 0.44% NA
All Indica  2759 75.90% 21.70% 2.32% 0.04% NA
All Japonica  1512 61.60% 33.10% 5.16% 0.07% NA
Aus  269 98.50% 1.10% 0.00% 0.37% NA
Indica I  595 70.60% 24.50% 4.87% 0.00% NA
Indica II  465 54.60% 42.40% 3.01% 0.00% NA
Indica III  913 87.30% 12.30% 0.44% 0.00% NA
Indica Intermediate  786 79.30% 18.40% 2.16% 0.13% NA
Temperate Japonica  767 87.70% 7.20% 5.08% 0.00% NA
Tropical Japonica  504 17.50% 77.80% 4.76% 0.00% NA
Japonica Intermediate  241 71.00% 22.40% 6.22% 0.41% NA
VI/Aromatic  96 6.20% 71.90% 4.17% 17.71% NA
Intermediate  90 50.00% 42.20% 6.67% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0108957658 A -> T LOC_Os01g15900.1 upstream_gene_variant ; 4946.0bp to feature; MODIFIER silent_mutation Average:68.165; most accessible tissue: Minghui63 flag leaf, score: 87.326 N N N N
vg0108957658 A -> T LOC_Os01g15910.1 upstream_gene_variant ; 753.0bp to feature; MODIFIER silent_mutation Average:68.165; most accessible tissue: Minghui63 flag leaf, score: 87.326 N N N N
vg0108957658 A -> T LOC_Os01g15900-LOC_Os01g15910 intergenic_region ; MODIFIER silent_mutation Average:68.165; most accessible tissue: Minghui63 flag leaf, score: 87.326 N N N N
vg0108957658 A -> DEL N N silent_mutation Average:68.165; most accessible tissue: Minghui63 flag leaf, score: 87.326 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0108957658 NA 1.46E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 2.73E-11 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 3.06E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 2.34E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 5.43E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 1.12E-10 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 3.71E-10 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 7.26E-11 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 2.31E-09 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 8.37E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 1.10E-08 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 2.43E-09 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 6.91E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 4.22E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 4.50E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 6.20E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 2.57E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 8.08E-06 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 9.30E-10 mr1733_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 2.18E-07 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108957658 NA 1.46E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251