\
| Variant ID: vg0108957658 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 8957658 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 245. )
GCATTTCAAATGGGGCCTTAATCTCTAACTCTTGCTCAATGGATTGGGCCTGGTTGTAGTTTTACAAATTTACAATACAATAATGTAGAAGGGAAAGTCT[A/T]
TTTTTTTCTCCCTTGATTATAAGTCGAGTCTGATTGGCATCCACTAATCGCACAACCAGATATAGAGAGTCCTTAAACTATCAAACCGGCTTGTTTTGAC
GTCAAAACAAGCCGGTTTGATAGTTTAAGGACTCTCTATATCTGGTTGTGCGATTAGTGGATGCCAATCAGACTCGACTTATAATCAAGGGAGAAAAAAA[T/A]
AGACTTTCCCTTCTACATTATTGTATTGTAAATTTGTAAAACTACAACCAGGCCCAATCCATTGAGCAAGAGTTAGAGATTAAGGCCCCATTTGAAATGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.70% | 25.60% | 3.22% | 0.44% | NA |
| All Indica | 2759 | 75.90% | 21.70% | 2.32% | 0.04% | NA |
| All Japonica | 1512 | 61.60% | 33.10% | 5.16% | 0.07% | NA |
| Aus | 269 | 98.50% | 1.10% | 0.00% | 0.37% | NA |
| Indica I | 595 | 70.60% | 24.50% | 4.87% | 0.00% | NA |
| Indica II | 465 | 54.60% | 42.40% | 3.01% | 0.00% | NA |
| Indica III | 913 | 87.30% | 12.30% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 79.30% | 18.40% | 2.16% | 0.13% | NA |
| Temperate Japonica | 767 | 87.70% | 7.20% | 5.08% | 0.00% | NA |
| Tropical Japonica | 504 | 17.50% | 77.80% | 4.76% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.00% | 22.40% | 6.22% | 0.41% | NA |
| VI/Aromatic | 96 | 6.20% | 71.90% | 4.17% | 17.71% | NA |
| Intermediate | 90 | 50.00% | 42.20% | 6.67% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0108957658 | A -> T | LOC_Os01g15900.1 | upstream_gene_variant ; 4946.0bp to feature; MODIFIER | silent_mutation | Average:68.165; most accessible tissue: Minghui63 flag leaf, score: 87.326 | N | N | N | N |
| vg0108957658 | A -> T | LOC_Os01g15910.1 | upstream_gene_variant ; 753.0bp to feature; MODIFIER | silent_mutation | Average:68.165; most accessible tissue: Minghui63 flag leaf, score: 87.326 | N | N | N | N |
| vg0108957658 | A -> T | LOC_Os01g15900-LOC_Os01g15910 | intergenic_region ; MODIFIER | silent_mutation | Average:68.165; most accessible tissue: Minghui63 flag leaf, score: 87.326 | N | N | N | N |
| vg0108957658 | A -> DEL | N | N | silent_mutation | Average:68.165; most accessible tissue: Minghui63 flag leaf, score: 87.326 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0108957658 | NA | 1.46E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 2.73E-11 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 3.06E-07 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 2.34E-06 | mr1740 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 5.43E-06 | mr1741 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 1.12E-10 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 3.71E-10 | mr1089_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 7.26E-11 | mr1093_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 2.31E-09 | mr1251_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 8.37E-07 | mr1257_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 1.10E-08 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 2.43E-09 | mr1435_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 6.91E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 4.22E-07 | mr1570_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 4.50E-10 | mr1580_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 6.20E-06 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 2.57E-08 | mr1599_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 8.08E-06 | mr1668_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 9.30E-10 | mr1733_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 2.18E-07 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108957658 | NA | 1.46E-06 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |