\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0108656918:

Variant ID: vg0108656918 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 8656918
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCACGTCAAACGAAACCAGGGACTATACTGCCGAGGGACCTTATTTGCACGGGTTTTATAAGTTGGGGATGCGTTGTATCTGGTTTTGTGCTGCAGGGA[C/T]
GAAAATCGGACTAAGAGACAAATAAAGGGACCTAAAGTGAACTTATGCCTTCTTTGTTACAGTTTGTCAGCGCTGCTGCTGAGACGGCCCAGGCCCACGG

Reverse complement sequence

CCGTGGGCCTGGGCCGTCTCAGCAGCAGCGCTGACAAACTGTAACAAAGAAGGCATAAGTTCACTTTAGGTCCCTTTATTTGTCTCTTAGTCCGATTTTC[G/A]
TCCCTGCAGCACAAAACCAGATACAACGCATCCCCAACTTATAAAACCCGTGCAAATAAGGTCCCTCGGCAGTATAGTCCCTGGTTTCGTTTGACGTGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.80% 36.90% 4.89% 9.33% NA
All Indica  2759 78.90% 7.80% 6.71% 6.67% NA
All Japonica  1512 3.30% 94.80% 1.59% 0.26% NA
Aus  269 0.70% 1.50% 4.83% 92.94% NA
Indica I  595 67.10% 18.30% 14.62% 0.00% NA
Indica II  465 76.10% 6.70% 5.38% 11.83% NA
Indica III  913 90.80% 1.90% 1.42% 5.91% NA
Indica Intermediate  786 75.60% 7.30% 7.63% 9.54% NA
Temperate Japonica  767 2.50% 96.30% 1.17% 0.00% NA
Tropical Japonica  504 4.60% 93.30% 1.59% 0.60% NA
Japonica Intermediate  241 3.30% 93.40% 2.90% 0.41% NA
VI/Aromatic  96 37.50% 60.40% 1.04% 1.04% NA
Intermediate  90 48.90% 40.00% 8.89% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0108656918 C -> T LOC_Os01g15448.1 upstream_gene_variant ; 146.0bp to feature; MODIFIER silent_mutation Average:99.195; most accessible tissue: Zhenshan97 panicle, score: 99.913 N N N N
vg0108656918 C -> T LOC_Os01g15460.1 downstream_gene_variant ; 2457.0bp to feature; MODIFIER silent_mutation Average:99.195; most accessible tissue: Zhenshan97 panicle, score: 99.913 N N N N
vg0108656918 C -> T LOC_Os01g15460.2 downstream_gene_variant ; 2457.0bp to feature; MODIFIER silent_mutation Average:99.195; most accessible tissue: Zhenshan97 panicle, score: 99.913 N N N N
vg0108656918 C -> T LOC_Os01g15460.3 downstream_gene_variant ; 2457.0bp to feature; MODIFIER silent_mutation Average:99.195; most accessible tissue: Zhenshan97 panicle, score: 99.913 N N N N
vg0108656918 C -> T LOC_Os01g15438-LOC_Os01g15448 intergenic_region ; MODIFIER silent_mutation Average:99.195; most accessible tissue: Zhenshan97 panicle, score: 99.913 N N N N
vg0108656918 C -> DEL N N silent_mutation Average:99.195; most accessible tissue: Zhenshan97 panicle, score: 99.913 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0108656918 C T 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0108656918 NA 2.57E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108656918 4.02E-06 NA mr1772 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251