\
| Variant ID: vg0108612596 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 8612596 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 295. )
ACCGGTCGAATATACTCACCATCGAACCATGCACAAGATTCATGCTCTTGTCGCCCTCCATAGTTCTGGCGTCTCTCCGACTACACACCGCAGTGAGGCA[G/A]
AGATCACCTCAACCATGAGGGAGGAGGGTGTTGGACTGGTGATCGTAGCAAGCCTGATGATAGGAGCCGCTAGAGATGGGGGAGATGCGGGATAGGGAGA
TCTCCCTATCCCGCATCTCCCCCATCTCTAGCGGCTCCTATCATCAGGCTTGCTACGATCACCAGTCCAACACCCTCCTCCCTCATGGTTGAGGTGATCT[C/T]
TGCCTCACTGCGGTGTGTAGTCGGAGAGACGCCAGAACTATGGAGGGCGACAAGAGCATGAATCTTGTGCATGGTTCGATGGTGAGTATATTCGACCGGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.30% | 0.40% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 98.20% | 1.20% | 0.60% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.30% | 1.70% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 1.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0108612596 | G -> A | LOC_Os01g15370.1 | upstream_gene_variant ; 76.0bp to feature; MODIFIER | silent_mutation | Average:57.042; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0108612596 | G -> A | LOC_Os01g15350-LOC_Os01g15370 | intergenic_region ; MODIFIER | silent_mutation | Average:57.042; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0108612596 | NA | 1.54E-08 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0108612596 | 7.01E-06 | 7.01E-06 | mr1067 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108612596 | NA | 2.10E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108612596 | 1.03E-06 | 1.09E-07 | mr1100 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108612596 | NA | 4.31E-06 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108612596 | NA | 2.57E-06 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108612596 | NA | 7.36E-07 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108612596 | NA | 2.88E-08 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108612596 | NA | 3.09E-06 | mr1618 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108612596 | NA | 5.95E-07 | mr1619 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108612596 | 7.17E-06 | 7.16E-06 | mr1795 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108612596 | NA | 3.75E-06 | mr1962 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108612596 | NA | 1.39E-06 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |