Variant ID: vg0108564628 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 8564628 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAGTCCAGACTAAATGCAAGATAACCAAGTTTAGATGCAAACCCTTAACTTCCTAGAACTGGCTGCATAGACACTAGAACTATTTTCACTGGAAAGTATC[G/A]
AATGCATGATACAAACAATTATCATTGAAAGAAAAATAGTTAACCAACTGTACAGTGCTTAATTATACTACAGGACATGATTTTATCATAACTTAGTATC
GATACTAAGTTATGATAAAATCATGTCCTGTAGTATAATTAAGCACTGTACAGTTGGTTAACTATTTTTCTTTCAATGATAATTGTTTGTATCATGCATT[C/T]
GATACTTTCCAGTGAAAATAGTTCTAGTGTCTATGCAGCCAGTTCTAGGAAGTTAAGGGTTTGCATCTAAACTTGGTTATCTTGCATTTAGTCTGGACTC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 97.60% | 1.60% | 0.85% | 0.00% | NA |
All Indica | 2759 | 99.50% | 0.00% | 0.54% | 0.00% | NA |
All Japonica | 1512 | 93.60% | 4.80% | 1.65% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 98.80% | 0.00% | 1.18% | 0.00% | NA |
Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.20% | 0.00% | 0.76% | 0.00% | NA |
Temperate Japonica | 767 | 96.60% | 1.40% | 1.96% | 0.00% | NA |
Tropical Japonica | 504 | 95.60% | 4.00% | 0.40% | 0.00% | NA |
Japonica Intermediate | 241 | 79.70% | 17.00% | 3.32% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0108564628 | G -> A | LOC_Os01g15300.1 | intron_variant ; MODIFIER | silent_mutation | Average:35.425; most accessible tissue: Callus, score: 54.781 | N | N | N | N |
vg0108564628 | G -> A | LOC_Os01g15300.2 | intron_variant ; MODIFIER | silent_mutation | Average:35.425; most accessible tissue: Callus, score: 54.781 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0108564628 | 1.54E-07 | 1.54E-07 | mr1098 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108564628 | 1.92E-06 | 1.92E-06 | mr1099 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108564628 | 9.40E-06 | 3.56E-06 | mr1101 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108564628 | NA | 5.63E-06 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108564628 | NA | 7.84E-08 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108564628 | NA | 4.23E-08 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108564628 | NA | 9.68E-08 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108564628 | NA | 1.60E-06 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108564628 | NA | 2.11E-06 | mr1120 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108564628 | 4.53E-07 | 9.45E-11 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/