RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0108564628:

Variant ID: vg0108564628 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 8564628
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGTCCAGACTAAATGCAAGATAACCAAGTTTAGATGCAAACCCTTAACTTCCTAGAACTGGCTGCATAGACACTAGAACTATTTTCACTGGAAAGTATC[G/A]
AATGCATGATACAAACAATTATCATTGAAAGAAAAATAGTTAACCAACTGTACAGTGCTTAATTATACTACAGGACATGATTTTATCATAACTTAGTATC

Reverse complement sequence

GATACTAAGTTATGATAAAATCATGTCCTGTAGTATAATTAAGCACTGTACAGTTGGTTAACTATTTTTCTTTCAATGATAATTGTTTGTATCATGCATT[C/T]
GATACTTTCCAGTGAAAATAGTTCTAGTGTCTATGCAGCCAGTTCTAGGAAGTTAAGGGTTTGCATCTAAACTTGGTTATCTTGCATTTAGTCTGGACTC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.60%	1.60%	0.85%	0.00%	NA
All Indica	2759	99.50%	0.00%	0.54%	0.00%	NA
All Japonica	1512	93.60%	4.80%	1.65%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	0.00%	1.18%	0.00%	NA
Indica II	465	99.60%	0.00%	0.43%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.00%	0.76%	0.00%	NA
Temperate Japonica	767	96.60%	1.40%	1.96%	0.00%	NA
Tropical Japonica	504	95.60%	4.00%	0.40%	0.00%	NA
Japonica Intermediate	241	79.70%	17.00%	3.32%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0108564628	G -> A	LOC_Os01g15300.1	intron_variant ; MODIFIER	silent_mutation	Average:35.425; most accessible tissue: Callus, score: 54.781	N	N	N	N
vg0108564628	G -> A	LOC_Os01g15300.2	intron_variant ; MODIFIER	silent_mutation	Average:35.425; most accessible tissue: Callus, score: 54.781	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0108564628	1.54E-07	1.54E-07	mr1098	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108564628	1.92E-06	1.92E-06	mr1099	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108564628	9.40E-06	3.56E-06	mr1101	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108564628	NA	5.63E-06	mr1113	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108564628	NA	7.84E-08	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108564628	NA	4.23E-08	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108564628	NA	9.68E-08	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108564628	NA	1.60E-06	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108564628	NA	2.11E-06	mr1120	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108564628	4.53E-07	9.45E-11	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 37 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg0108564628:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact