\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0108515482:

Variant ID: vg0108515482 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 8515482
Reference Allele: GAlternative Allele: T,C
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


AGGTTTGACAAAAACGTTTAAGAAATCAGCGACTAAATTTAAATTATCAAGCACAGCATAAATTTATCAGTATTGTACAGATTGAGCCTCCATCATCAAA[G/T,C]
ATTACATCATATGGAATCAACCAGACTCAGTTTTCTCATCATCAGACCCAGTCTGACCAAGATTGGTATCTTGAAATCTCTCTACAATGTCTGCAGCAAT

Reverse complement sequence

ATTGCTGCAGACATTGTAGAGAGATTTCAAGATACCAATCTTGGTCAGACTGGGTCTGATGATGAGAAAACTGAGTCTGGTTGATTCCATATGATGTAAT[C/A,G]
TTTGATGATGGAGGCTCAATCTGTACAATACTGATAAATTTATGCTGTGCTTGATAATTTAAATTTAGTCGCTGATTTCTTAAACGTTTTTGTCAAACCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.00% 0.80% 0.19% 0.00% NA
All Indica  2759 98.30% 1.30% 0.33% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.80% 4.90% 1.34% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 0.90% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0108515482 G -> T LOC_Os01g15180.1 downstream_gene_variant ; 344.0bp to feature; MODIFIER silent_mutation Average:32.839; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg0108515482 G -> T LOC_Os01g15190.1 downstream_gene_variant ; 17.0bp to feature; MODIFIER silent_mutation Average:32.839; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg0108515482 G -> T LOC_Os01g15180-LOC_Os01g15190 intergenic_region ; MODIFIER silent_mutation Average:32.839; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg0108515482 G -> C LOC_Os01g15180.1 downstream_gene_variant ; 344.0bp to feature; MODIFIER N Average:32.839; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg0108515482 G -> C LOC_Os01g15190.1 downstream_gene_variant ; 17.0bp to feature; MODIFIER N Average:32.839; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg0108515482 G -> C LOC_Os01g15180-LOC_Os01g15190 intergenic_region ; MODIFIER N Average:32.839; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0108515482 3.05E-08 1.33E-16 mr1038 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108515482 3.40E-08 9.13E-19 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108515482 2.78E-11 4.77E-21 mr1038_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108515482 1.88E-11 8.22E-21 mr1389_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251