\
| Variant ID: vg0108515482 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 8515482 |
| Reference Allele: G | Alternative Allele: T,C |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )
AGGTTTGACAAAAACGTTTAAGAAATCAGCGACTAAATTTAAATTATCAAGCACAGCATAAATTTATCAGTATTGTACAGATTGAGCCTCCATCATCAAA[G/T,C]
ATTACATCATATGGAATCAACCAGACTCAGTTTTCTCATCATCAGACCCAGTCTGACCAAGATTGGTATCTTGAAATCTCTCTACAATGTCTGCAGCAAT
ATTGCTGCAGACATTGTAGAGAGATTTCAAGATACCAATCTTGGTCAGACTGGGTCTGATGATGAGAAAACTGAGTCTGGTTGATTCCATATGATGTAAT[C/A,G]
TTTGATGATGGAGGCTCAATCTGTACAATACTGATAAATTTATGCTGTGCTTGATAATTTAAATTTAGTCGCTGATTTCTTAAACGTTTTTGTCAAACCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.00% | 0.80% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 1.30% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.80% | 4.90% | 1.34% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 0.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0108515482 | G -> T | LOC_Os01g15180.1 | downstream_gene_variant ; 344.0bp to feature; MODIFIER | silent_mutation | Average:32.839; most accessible tissue: Minghui63 flag leaf, score: 46.761 | N | N | N | N |
| vg0108515482 | G -> T | LOC_Os01g15190.1 | downstream_gene_variant ; 17.0bp to feature; MODIFIER | silent_mutation | Average:32.839; most accessible tissue: Minghui63 flag leaf, score: 46.761 | N | N | N | N |
| vg0108515482 | G -> T | LOC_Os01g15180-LOC_Os01g15190 | intergenic_region ; MODIFIER | silent_mutation | Average:32.839; most accessible tissue: Minghui63 flag leaf, score: 46.761 | N | N | N | N |
| vg0108515482 | G -> C | LOC_Os01g15180.1 | downstream_gene_variant ; 344.0bp to feature; MODIFIER | N | Average:32.839; most accessible tissue: Minghui63 flag leaf, score: 46.761 | N | N | N | N |
| vg0108515482 | G -> C | LOC_Os01g15190.1 | downstream_gene_variant ; 17.0bp to feature; MODIFIER | N | Average:32.839; most accessible tissue: Minghui63 flag leaf, score: 46.761 | N | N | N | N |
| vg0108515482 | G -> C | LOC_Os01g15180-LOC_Os01g15190 | intergenic_region ; MODIFIER | N | Average:32.839; most accessible tissue: Minghui63 flag leaf, score: 46.761 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0108515482 | 3.05E-08 | 1.33E-16 | mr1038 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108515482 | 3.40E-08 | 9.13E-19 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108515482 | 2.78E-11 | 4.77E-21 | mr1038_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108515482 | 1.88E-11 | 8.22E-21 | mr1389_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |