\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0108450212:

Variant ID: vg0108450212 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 8450212
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCAATTATTTTAAGCTCAATTATATCAAATTGTTTTAGTTTTTAATTAAATTATATTTTATTTGTATATAGTATATGCATCTTAATTTTTTGCAGCAA[C/T]
GCAGCGGGGTATTCGTATATGAATACTAACGAAGTAACGAGTGTGTAACCAAAATGAGTAGCAAAAGTAGGAGTAATTAGCAAAAAGACAAATTAAATCA

Reverse complement sequence

TGATTTAATTTGTCTTTTTGCTAATTACTCCTACTTTTGCTACTCATTTTGGTTACACACTCGTTACTTCGTTAGTATTCATATACGAATACCCCGCTGC[G/A]
TTGCTGCAAAAAATTAAGATGCATATACTATATACAAATAAAATATAATTTAATTAAAAACTAAAACAATTTGATATAATTGAGCTTAAAATAATTGAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.50% 31.70% 8.74% 5.01% NA
All Indica  2759 81.90% 5.60% 9.64% 2.90% NA
All Japonica  1512 14.90% 81.10% 3.84% 0.13% NA
Aus  269 11.90% 4.10% 27.88% 56.13% NA
Indica I  595 67.20% 11.10% 21.68% 0.00% NA
Indica II  465 84.90% 4.90% 8.39% 1.72% NA
Indica III  913 92.90% 1.30% 2.08% 3.72% NA
Indica Intermediate  786 78.40% 6.70% 10.05% 4.83% NA
Temperate Japonica  767 4.00% 93.70% 2.22% 0.00% NA
Tropical Japonica  504 27.80% 66.30% 5.56% 0.40% NA
Japonica Intermediate  241 22.80% 71.80% 5.39% 0.00% NA
VI/Aromatic  96 12.50% 84.40% 3.12% 0.00% NA
Intermediate  90 53.30% 30.00% 12.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0108450212 C -> T LOC_Os01g15029.1 upstream_gene_variant ; 3158.0bp to feature; MODIFIER silent_mutation Average:53.474; most accessible tissue: Callus, score: 85.158 N N N N
vg0108450212 C -> T LOC_Os01g15039.1 intron_variant ; MODIFIER silent_mutation Average:53.474; most accessible tissue: Callus, score: 85.158 N N N N
vg0108450212 C -> DEL N N silent_mutation Average:53.474; most accessible tissue: Callus, score: 85.158 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0108450212 NA 6.86E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108450212 NA 2.65E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108450212 NA 2.16E-13 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108450212 NA 7.60E-09 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108450212 NA 9.13E-18 mr1131_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108450212 NA 8.09E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0108450212 NA 3.51E-19 mr1720_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251